View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11045_high_21 (Length: 219)
Name: NF11045_high_21
Description: NF11045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11045_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 9 - 201
Target Start/End: Complemental strand, 8531841 - 8531649
Alignment:
| Q |
9 |
gagaagcagagattgatattaagagattaaaagtttgagaataatgagagcagtattattgctttctcaatttctgttataaaatgcatacaacatagaa |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8531841 |
gagaagaagagattgatattaagagattaaaagtttgagaataatgagagcagtattattgctttctcaatttctgttataaaatgcatacaacatataa |
8531742 |
T |
 |
| Q |
109 |
accacttatagacatggttttgttacaataaattgcttaacacgcaagcaatgcatataacaaaccctaactgttttattggcaagctaaact |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8531741 |
accacttatagacatggttttgttacaatagattgcttaacacgcaagcaatgcatataacaaaccctaactgttttattggcaagctaaact |
8531649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University