View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11045_low_13 (Length: 289)
Name: NF11045_low_13
Description: NF11045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11045_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 4 - 278
Target Start/End: Complemental strand, 4564630 - 4564355
Alignment:
| Q |
4 |
atctctctcttctcctatgcgtctattcattgaaaatcatcaatcatatttttcatctgttagatgaagatcagatgacttagattacaaattttgtttt |
103 |
Q |
| |
|
|||||||| |||| ||||| |||||||||||||||||||||| ||||||||| |||| || |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
4564630 |
atctctcttctctcatatgcatctattcattgaaaatcatcaaccatattttttatctattgcatgaagatcagacggcttagattacaaattttgtttt |
4564531 |
T |
 |
| Q |
104 |
atagatttaatttattgagtttaaaatatgagttgattaattttcatctaataattttgatgtattcattgagaaaattcattttagtgacaaattaaca |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4564530 |
atagatttaatttattgaatttaaaatacgagttgactaattttcatctaataattttgatgtattcattgaagaaattcattttagtgacaaattaaca |
4564431 |
T |
 |
| Q |
204 |
tactacattttgtagaaataaaatcatct-aaaatttgtataacatgtatcatttaattttgatttaatggttcat |
278 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||| ||||||||||| | | |||||||||||||| ||||| |
|
|
| T |
4564430 |
tactacattttgtagaaataaaatcatctaaaaaattgtgtaacatgtatcgtctgattttgatttaatgattcat |
4564355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University