View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11045_low_15 (Length: 263)

Name: NF11045_low_15
Description: NF11045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11045_low_15
NF11045_low_15
[»] chr1 (2 HSPs)
chr1 (19-252)||(8554083-8554316)
chr1 (19-252)||(8558558-8558791)
[»] chr3 (1 HSPs)
chr3 (19-252)||(53738482-53738715)


Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 8554083 - 8554316
Alignment:
19 cattgttgcgagaaaggatattattttggatggttcacacccttgtttattatatggatatggcggttataacattagtcttacaccatcttttagcgtc 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8554083 cattgttgcgagaaaggatattattttggatggttcacacccttgtttattatatggatatggcggttataacattagtcttacaccatcttttagcgtc 8554182  T
119 agccatattgtcctagcaagatatttaggttttgttttctgcatagcaaatatccgtggcggtggagaatacggagaggaatggcataaagcagcatccc 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8554183 agccatattgtcctagcaagatatttaggttttgttttctgcatagcaaatatccgtggcggtggagaatacggagaggaatggcataaagcagcatccc 8554282  T
219 tttcaaacaagcaaaattgctttgatgacttcat 252  Q
    ||||||||||||||||||||||||||||||||||    
8554283 tttcaaacaagcaaaattgctttgatgacttcat 8554316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 8558558 - 8558791
Alignment:
19 cattgttgcgagaaaggatattattttggatggttcacacccttgtttattatatggatatggcggttataacattagtcttacaccatcttttagcgtc 118  Q
    ||||||| | ||||||||||| |||||| ||||||||||||||||||| |||||||||||||| |||| |||| | ||||||||||||| ||| || |||    
8558558 cattgtttccagaaaggatataattttgaatggttcacacccttgtttgttatatggatatggtggttttaacgtcagtcttacaccatttttcagtgtc 8558657  T
119 agccatattgtcctagcaagatatttaggttttgttttctgcatagcaaatatccgtggcggtggagaatacggagaggaatggcataaagcagcatccc 218  Q
    || | ||||||||| |||||  ||||||||| |||| |||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||| |||||    
8558658 agtcgtattgtccttgcaaggcatttaggttctgttatctgcatagcaaatattcgtggtggtggagaatacggagaggagtggcataaagcaggatccc 8558757  T
219 tttcaaacaagcaaaattgctttgatgacttcat 252  Q
    |||| || ||||||||||||||||||||||||||    
8558758 tttcgaaaaagcaaaattgctttgatgacttcat 8558791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 53738482 - 53738715
Alignment:
19 cattgttgcgagaaaggatattattttggatggttcacacccttgtttattatatggatatggcggttataacattagtcttacaccatcttttagcgtc 118  Q
    ||||||||| | |||||||||| |||| |||||||||||||| ||| | |||||||||||||| |||| |||||| ||| |||||||||| || || ||     
53738482 cattgttgcaaaaaaggatattgttttcgatggttcacacccgtgtctgttatatggatatggtggttttaacatcagtattacaccatccttcagtgtt 53738581  T
119 agccatattgtcctagcaagatatttaggttttgttttctgcatagcaaatatccgtggcggtggagaatacggagaggaatggcataaagcagcatccc 218  Q
    || |  ||||| ||  ||| | ||||||||||||||| |||||| || ||||| ||||| ||||||||||| || || ||||||||||||||||  ||||    
53738582 agtcgcattgtactcacaaaacatttaggttttgtttactgcattgcgaatattcgtggtggtggagaatatggggaagaatggcataaagcaggttccc 53738681  T
219 tttcaaacaagcaaaattgctttgatgacttcat 252  Q
    || | || || || ||||||||||||||||||||    
53738682 ttgctaaaaaacagaattgctttgatgacttcat 53738715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University