View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11045_low_19 (Length: 242)
Name: NF11045_low_19
Description: NF11045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11045_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 34842023 - 34841917
Alignment:
| Q |
1 |
ccagctgtatataagaaattcactttgagggagtatagacaacagactctgaacgatgtcaaagaaacaggagataaagtggggctctctagatttgttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34842023 |
ccagctgtatataagaaattcactttgagggagtatagacaacagacactgaacgatgtcaaagaaacaggagataaagtggggctctctagatttgttc |
34841924 |
T |
 |
| Q |
101 |
tttagaa |
107 |
Q |
| |
|
||||||| |
|
|
| T |
34841923 |
tttagaa |
34841917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University