View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11047_low_3 (Length: 254)
Name: NF11047_low_3
Description: NF11047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11047_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 40891296 - 40891074
Alignment:
| Q |
17 |
agaaatttcccctgttagaggagatttacatttcagaatgcttagaatctaatatatctcttgaagttattggccaaagttgtccttcgttgaaatcact |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
40891296 |
agaaatttcccctgttagaggagatttacatttcataatgcttagaatctaatatatctcttgaagttattgggcaaagttgtcctgcgttgaaatcact |
40891197 |
T |
|
| Q |
117 |
aacattctatgggatgtcggatggagaacgtttcacgtgtgatgataaggcatttattattgcaaaaacaatgcctgggctactccatcttcttcttcat |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||| |
|
|
| T |
40891196 |
aacattctatgcgatgtcggatggagaacacttcacgtgtgatgataaggcatttattattgcaaaaaaaatgcatgggctactccatcttgttcttcat |
40891097 |
T |
|
| Q |
217 |
ggagaccctctcagtgatgttgg |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40891096 |
ggagaccctctcagtgatgttgg |
40891074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 30621763 - 30621541
Alignment:
| Q |
17 |
agaaatttcccctgttagaggagatttacatttcagaatgcttagaatctaatatatctcttgaagttattggccaaagttgtccttcgttgaaatcact |
116 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| | || | ||||| | |||||||||||||||||| |||||||||||| |||| ||| || |
|
|
| T |
30621763 |
agaagtttcccctgttagaggagattaacatttcatatggcatccaatctgggaaatctcttgaagttattggtcaaagttgtcctcttttgagatcgct |
30621664 |
T |
|
| Q |
117 |
aacattctatgggatgtcggatggagaacgtttcacgtgtgatgataaggcatttattattgcaaaaacaatgcctgggctactccatcttcttcttcat |
216 |
Q |
| |
|
|||||| | ||| |||| || ||| || |||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||| | ||||| |
|
|
| T |
30621663 |
aacatttaacggggcgtcgtatagaggccgcttcaagtgtgatgatgaggcatttattattgcaaaaacaatgcctgggctacgccatcttgatattcat |
30621564 |
T |
|
| Q |
217 |
ggagaccctctcagtgatgttgg |
239 |
Q |
| |
|
||| ||||||||||||| ||||| |
|
|
| T |
30621563 |
ggaaaccctctcagtgaagttgg |
30621541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 207
Target Start/End: Original strand, 38285498 - 38285685
Alignment:
| Q |
17 |
agaaatttcccctgttagaggagatttacatttcagaatgcttagaatctaatatatctcttgaagttattggccaaagttgtccttcgttgaaatcact |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | |||| || |||| ||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
38285498 |
agaaatttcccctgttagaggagattgacatttcacacggcttccaaactaagatatctcttgaagttattggccaaaattgtcctttgttgaaatcact |
38285597 |
T |
|
| Q |
117 |
aacattctatgggatgtcggatggagaacgtttcacgtgtgatgataaggcatttattattgcaaaaacaatgcctgggctactccatctt |
207 |
Q |
| |
|
| || |||||||||| |||||| || || ||| |||| ||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
38285598 |
agtatataatgggatgtcctatggaggccgcagcaagtgcgatg---aggcatttattattgcaaagacaatgcctgggctacgccatctt |
38285685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University