View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11048_high_32 (Length: 231)
Name: NF11048_high_32
Description: NF11048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11048_high_32 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 231
Target Start/End: Complemental strand, 1216353 - 1216137
Alignment:
| Q |
7 |
tggacatcagcagttggaattcctggtaattaaactgggctagataagccttatttgatgttactatactattcagcaatggtaatgtctataataagat |
106 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1216353 |
tggacctcagcagttggaattcctg-taattaaactgggctagataagccttatttgatgttactatactattcagcaatggtaatgtctat-------t |
1216262 |
T |
|
| Q |
107 |
gggtgctctttcggctctctacaaatgcgcaaattgttgaacgttatcttttgtgtttttaaagatttcaggagaaaactttcagatgtttttcgggatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1216261 |
gggtgctctttcggctctctacaaatgcgcaaattgttgaacgttatcttttgtgtttttaaagatttcaggagaaaactttcagatgtttttcggaatt |
1216162 |
T |
|
| Q |
207 |
cttagaagtcgtggttgagtctaac |
231 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1216161 |
cttagaagtcgtggttgagtctaac |
1216137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University