View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11048_low_25 (Length: 276)
Name: NF11048_low_25
Description: NF11048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11048_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 32602863 - 32603102
Alignment:
| Q |
18 |
gtaagggacaaaaattcgtccactaattaatatggccccatgctttcaaattgtcggattccaattattttttccagtaacatacacaattcattcttgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||||| | ||||| || |
|
|
| T |
32602863 |
gtaagggacaaaaattcgtccactaataaatatggccccatggttccaaattgtcggattccaattattttttccagtaacaca--------attctagc |
32602954 |
T |
|
| Q |
118 |
tagcnnnnnnncctttgcgtaagcacattagnnnnnnnnnnnnnnnncatggtgaattgattgaagcttttacctgaaagtgagagccattataaaagta |
217 |
Q |
| |
|
|||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32602955 |
tagctttttttcatttgcgtaagcacattagtttttgtttttgttttcatggtgaattgattgaagcttttacctgaaagtgagagccattataaaagta |
32603054 |
T |
|
| Q |
218 |
atagctggaaggacattaacagtggcagatgcaaacgttgttgatgtc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32603055 |
atagctggaaggacattaacagtggcagatgcaaacgttgttgatgtc |
32603102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 189 - 261
Target Start/End: Original strand, 10602415 - 10602487
Alignment:
| Q |
189 |
acctgaaagtgagagccattataaaagtaatagctggaaggacattaacagtggcagatgcaaacgttgttga |
261 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| ||||| || | ||||||||||||||||||||||||||||| |
|
|
| T |
10602415 |
acctgaaaatgattgccattataaaagtaattgctggcagaatgttaacagtggcagatgcaaacgttgttga |
10602487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University