View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11048_low_29 (Length: 245)
Name: NF11048_low_29
Description: NF11048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11048_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 8 - 241
Target Start/End: Complemental strand, 50789267 - 50789040
Alignment:
| Q |
8 |
attttgtactttacgcgttgagctgaaaaactgaactttgttgtttcaaaccttggaagtggatttttgctttcgattcatattaaattaaatttagaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50789267 |
attttgtactttacgcgttgagctgaaaaactgaactttgttgtttcaaaccttggaagtggatttttgctttcgattcatattaaattaaatttagaat |
50789168 |
T |
 |
| Q |
108 |
ggtctcaaattttctgcattttgacagtgatttttatatcatgttttagctnnnnnnnnnttgtacacttctaagaagtcttagatgttaatatctctac |
207 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50789167 |
ggtctcaaatattctgcattttgacagtgatttttatatcatgttttagct--aaaaaaattgtacacttctaagaagtcttagatgttaatatct---- |
50789074 |
T |
 |
| Q |
208 |
atacatacatgccttgattctggtctctgctgct |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
50789073 |
ttacatacatgccttgattctggtttctgctgct |
50789040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University