View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11048_low_33 (Length: 239)
Name: NF11048_low_33
Description: NF11048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11048_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 40007692 - 40007914
Alignment:
| Q |
1 |
tgctttgatatccatgaggtctttggctcccgaggtatttgaatggaccggtaggagtatcactgaatgctatgccaacggaagctttggcgtaattggc |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40007692 |
tgctttgatatcgatgaggtctttggctcccgaggtatttgaatggaccggtaggagtatcactgaatgctatgccaacggtagctttggcgtaattggc |
40007791 |
T |
|
| Q |
101 |
gttgtcgatatgcatccacatcacatactttcttgttttttcattgtaaataacttttggtctctcaagcacattggacttgtgtagatcatgtgtttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40007792 |
gttgtcgatatgcatccacatcacatactttcttgttttttcattgtaaataacttttggtctctcaagcacattggacttgtgtagatcatgtgtttta |
40007891 |
T |
|
| Q |
201 |
tctgttttctctgctgctaatgc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40007892 |
tctgttttctctgctgctaatgc |
40007914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 60 - 217
Target Start/End: Complemental strand, 5353333 - 5353176
Alignment:
| Q |
60 |
tcactgaatgctatgccaacggaagctttggcgtaattggcgttgtcgatatgcatccacatcacatactttcttgttttttcattgtaaataacttttg |
159 |
Q |
| |
|
||||||| ||||| |||||| || ||||||| ||| || || | || |||||||||||||||||||||||| || || ||||||||||| ||||||| |
|
|
| T |
5353333 |
tcactgattgctacgccaacagacgctttggtgtagttagcatcatcaatatgcatccacatcacatacttttcagtcttctcattgtaaatcacttttg |
5353234 |
T |
|
| Q |
160 |
gtctctcaagcacattggacttgtgtagatcatgtgttttatctgttttctctgctgc |
217 |
Q |
| |
|
| ||||| ||||| || || ||||| |||||||| |||| |||||||| ||||||||| |
|
|
| T |
5353233 |
gcctctcgagcacgttagatttgtgcagatcatgggtttcatctgtttcctctgctgc |
5353176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University