View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11048_low_35 (Length: 223)
Name: NF11048_low_35
Description: NF11048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11048_low_35 |
 | |
|
| [»] scaffold0036 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 5 - 205
Target Start/End: Complemental strand, 22559 - 22359
Alignment:
| Q |
5 |
gtggagaagcagagaagtgtgagtatttttacacttatggtgataaatcttacaccattggagatttgggtactgattccatcaactttggagaaaaaga |
104 |
Q |
| |
|
|||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22559 |
gtggagaatcaaataagtgtgagtatttttacacttatggtgataaatcttacaccattggagatttgggtactgattccatcaactttggagaaaaaga |
22460 |
T |
|
| Q |
105 |
tgttacatttcctaaatcaatttttggatgtggacatcgaaatgatgtcacatttaaaagaagccgaaaagctacgggtcttgttggtcttggagcagga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22459 |
tgttacatttcctaaatcaatttttggatgtggacatcaaaatgatgtcacatttaaaagaagccgaaaagctacgggtcttgttggtcttggagcagga |
22360 |
T |
|
| Q |
205 |
c |
205 |
Q |
| |
|
| |
|
|
| T |
22359 |
c |
22359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 94 - 150
Target Start/End: Complemental strand, 14432 - 14376
Alignment:
| Q |
94 |
ggagaaaaagatgttacatttcctaaatcaatttttggatgtggacatcgaaatgat |
150 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||| || ||||||| |
|
|
| T |
14432 |
ggagaaaaagatgttacatttccaaaatcagtttttggatgtggacttcaaaatgat |
14376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University