View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_high_14 (Length: 480)
Name: NF1104_high_14
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 30 - 244
Target Start/End: Complemental strand, 38225400 - 38225186
Alignment:
| Q |
30 |
aatactatagtgtgtgcagcttcttcaaaaggaccggctttggttgaccatgacgagggaacaagcaccggagaaactttaatatttgttcttttgcttc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225400 |
aatactatagtgtgtgcagcttcttcaaaaggaccggctttggttgaccatgacgagggaacaagcaccggagaaactttaatatttgttcttttgcttc |
38225301 |
T |
 |
| Q |
130 |
atatctttgctgttaaaaggtaatctggcttgcatcagtattagtaaaataaaagagcacttttttatttgaacaatttctgaagggccaatttttgctc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38225300 |
atatctttgctgttaaaaggtaatctggcttgcatcagtattagtaaaataaaagagcacttttttatttgaacaatttctgcagggccaatttttgctc |
38225201 |
T |
 |
| Q |
230 |
gagggggagtagtag |
244 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38225200 |
gagggggagtagtag |
38225186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 311 - 468
Target Start/End: Complemental strand, 38225119 - 38224965
Alignment:
| Q |
311 |
gaactagacatagatcctcaaatcctgcgggtgcctaaaatttgttttagaaaacatttaatagttagagatataaaattggaccctctcattataattt |
410 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225119 |
gaactagacatagatcctcaaatcctgtgggtgcctaaaatttgtt---gaaaacatttaatagttagagatataaaattggaccctctcattataattt |
38225023 |
T |
 |
| Q |
411 |
gatatatccaagttgcaaattttgaaaactgtctttaaattgtatcagaaaatatatt |
468 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225022 |
gatatatccaagttgcaaattttgaaaactgtctttaaattgtatcagaaaatatatt |
38224965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University