View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_high_29 (Length: 385)
Name: NF1104_high_29
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 2e-28; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 24900754 - 24900822
Alignment:
| Q |
30 |
gttcatgttataggtttgggggatggttgcaacatttgttgaatatcatgtcctttggtatttcattga |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24900754 |
gttcatgttataggtttgggggatggttgcaacatttgttgaatatcatgtcctttggtacttcattga |
24900822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 178 - 245
Target Start/End: Original strand, 24900843 - 24900906
Alignment:
| Q |
178 |
tagatcggggagcgggtgacaaacaatagtaaagttgattgaatgatttagtgacctattaggttcgg |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24900843 |
tagatcggggagcgggtgacaa----tagtaaagttgattgaatgatttagtgacctattaggttcgg |
24900906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 257 - 374
Target Start/End: Original strand, 24900931 - 24901043
Alignment:
| Q |
257 |
taaattaaaaggtcgcaaatgacttgcaaatatggcctaaaagttgcataatttnnnnnnnnnnnnnnnnntgacggaacataacctgcaaaatgtcctt |
356 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
24900931 |
taaattaaaaggtcgtaaatgacttgcaaatatggcctaaaagttgcataatttaaaaaaaaaaaa-----tgacggaacataacctgcaatatgtcctt |
24901025 |
T |
|
| Q |
357 |
tttactctattaagtata |
374 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
24901026 |
tttactctattaactata |
24901043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 76
Target Start/End: Complemental strand, 24883989 - 24883951
Alignment:
| Q |
38 |
tataggtttgggggatggttgcaacatttgttgaatatc |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24883989 |
tataggtttgggggctggttgcaacatttgttgaatatc |
24883951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University