View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_high_34 (Length: 372)
Name: NF1104_high_34
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 48443461 - 48443226
Alignment:
| Q |
1 |
gtattcttccaacatagtgaatggcaactcatttcccaaatcaatcggcccaatgctttctttcatcaataactctgagaatggagcttgaaagcctgcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48443461 |
gtattcttccaacatagtgaatggcaactcatttcccaaatcaatcggcccaatgctttctttcatcaataactctgagaatggagcttgaaagcctgcc |
48443362 |
T |
|
| Q |
101 |
ttttcaagattaccaccgttctctgggacgaccatcagggaatgatggaacaaggaccttttcattattctgtcttgcgtcttgaactcgtgtaattgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48443361 |
ttttcaagattaccaccgttctctggtacgaccatcagggaatgatggaacaaggaccttttcattattctgtcttgcgtcttgaactcgtgtaattgtc |
48443262 |
T |
|
| Q |
201 |
tttctcttttcaatttccgatgtttctgcctcctcg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48443261 |
tttctcttttcaatttccgatgtttctgcctcctcg |
48443226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 323 - 362
Target Start/End: Complemental strand, 48443124 - 48443085
Alignment:
| Q |
323 |
tgaccattcttgttcctcttcaccactttcatcctctctg |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48443124 |
tgaccattcttgttcctcttcaccactttcatcctgtctg |
48443085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University