View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_high_61 (Length: 268)
Name: NF1104_high_61
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_high_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 52824231 - 52824463
Alignment:
| Q |
1 |
tatcccaggttggaagtgtgaagatttccttgattcgccttcttcttctgttcactctcatgaactacaacaccagaatcatatagtgcatgatgatgct |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824231 |
tatcccaggttggaagtttgaagatttccttgattccccttcttcttctgttccctctcatgaactacaacaccagaatcatatagtgcatgatgatgct |
52824330 |
T |
 |
| Q |
101 |
aattatcatattcatgaggaaaatattctggtttctttctctagcgagagcatgcgtaggatctgtgttcctcaagcaccactgtattattctgaaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824331 |
aattatcatattcatgaggaaaatattctggtttctttctctagcgagagcatgcgtaggatctgtgttcctcaagcaccactgtattattctgaaaaaa |
52824430 |
T |
 |
| Q |
201 |
tggataacagatcaaacaccgtcaatttcagca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52824431 |
tggataacagatcaaacaccgtcaatttcagca |
52824463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University