View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_high_64 (Length: 266)
Name: NF1104_high_64
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_high_64 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 8 - 214
Target Start/End: Complemental strand, 39775259 - 39775053
Alignment:
| Q |
8 |
tagcataggatggaggaacaattcaatgactaggtgttgacttgtatcttgacttgagtttggttggatggtttattcannnnnnnncttcatttggcat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39775259 |
tagcataggatggaggaacaattcaatgactaggtgttgacttgtatcttgacttgagtttggttggatggtttattcattttttttgttcatttggcat |
39775160 |
T |
|
| Q |
108 |
ttatttttaaataaaaatgttgttccccatttaatccatcaatataagttcacatatagtttcccgaatttcaatattctaatttaagataaatattact |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39775159 |
ttatttttaaataaaaatgttgaaccccatttaatccatcaatataagttcacacatagtttcccgaatatcaatattctaatttaagataaatattacc |
39775060 |
T |
|
| Q |
208 |
gtaaaca |
214 |
Q |
| |
|
||||||| |
|
|
| T |
39775059 |
gtaaaca |
39775053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University