View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_high_93 (Length: 232)
Name: NF1104_high_93
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_high_93 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 41939718 - 41939851
Alignment:
| Q |
1 |
caagatgatgaacatggtggctctgaaattgagcaagaaaatgaatcttttcagtcatagtttgatgtatgtgtgttttaactataaagacaagacagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41939718 |
caagatgatgaacatggtggctctgaaattgagcaagaaaatgaatcttttcagtcatagtttgatgtatgtatgttttaactataaagacaagacagct |
41939817 |
T |
|
| Q |
101 |
atggacatgttttgcactaattacattggtgact |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41939818 |
atggacatgttttgcactaattacattggtgact |
41939851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University