View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_high_98 (Length: 220)
Name: NF1104_high_98
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_high_98 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 37059612 - 37059403
Alignment:
| Q |
1 |
tattttgaatcaacggtac--ctctgacaatgttattatttacaagaaattgttcacggtatatagaagtctaagaagaagggtgatgttgctttcaagt |
98 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37059612 |
tattttgaatcaacggtacacctctgacaatgttattatttacaagaaattgttcacggtatatagaagtctaagaagaagggtgatgttgctttcaagt |
37059513 |
T |
 |
| Q |
99 |
ttcaagcttgatttggaaaaacctttgacaatgttaatgactatttggtatgagatattgttcgcagtaagtttaagtttagttagtaaaatattcaatc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37059512 |
ttcaagcttgatttggaaaaacctttgacaatgttaatgactatttggtatgagatattgttcgcagtaagtttaagtttagttagtaaaacattcaatc |
37059413 |
T |
 |
| Q |
199 |
taaggatatt |
208 |
Q |
| |
|
|||||||||| |
|
|
| T |
37059412 |
taaggatatt |
37059403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University