View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_low_110 (Length: 243)
Name: NF1104_low_110
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_low_110 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 11 - 233
Target Start/End: Complemental strand, 20422737 - 20422515
Alignment:
| Q |
11 |
cttttcaaaggagactttgaagaaggtgttttttgttcttcccctttgaatgagatttggagactttcttcttcattctctgattctggaatagttgata |
110 |
Q |
| |
|
|||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
20422737 |
cttttcaaaggagagtttgaagaaggggtgttttgttcttcccctttgaatgagatttggagactttcttcttcattctttgattcttgaatagttgata |
20422638 |
T |
|
| Q |
111 |
tgttggaatctgcattcttcatttcatccaagatttgatcgtgaaactctagactctgagtcattatggacttatcaaatgacttataaagagattgaag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
20422637 |
tgttggaatctgcattcttcatttcatccaagatttgatcgtgaaactctagactttgagtcattgtgggcttatcaaatgacttataaagagattgaag |
20422538 |
T |
|
| Q |
211 |
ttaggttatttatttgttctctg |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
20422537 |
ttaggttatttatttgttctctg |
20422515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University