View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_low_111 (Length: 243)
Name: NF1104_low_111
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_low_111 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 243
Target Start/End: Original strand, 24357993 - 24358223
Alignment:
| Q |
13 |
cacagacagaaagcaattatagaccaaaaatagatggaattcatattaagtaccggaaactctttccttattcatgttgatttttagtaatgcaatatat |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24357993 |
cacagacagatagcaattatagaccaaaaatagatggaattcatattaagtaccggaaactctttccttattcatgttgatttttagtaatgcaatatat |
24358092 |
T |
 |
| Q |
113 |
aaaattgcagacaattggatttatggggccagctgttaccttgatctgcttgaattacgccaatacaccaacaatggcagctacactcttgactgcagct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24358093 |
aaaattgcagacaattggatttatggggccagctgttaccttgatctgcttgaattacgccaatacaccaacaatggcagctacactcttgactgcagct |
24358192 |
T |
 |
| Q |
213 |
ttaagcttaagctctttcagtcaagctggtt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24358193 |
ttaagcttaagctctttcagtcaagctggtt |
24358223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University