View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1104_low_115 (Length: 232)

Name: NF1104_low_115
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1104_low_115
NF1104_low_115
[»] chr2 (1 HSPs)
chr2 (1-134)||(41939718-41939851)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 41939718 - 41939851
Alignment:
1 caagatgatgaacatggtggctctgaaattgagcaagaaaatgaatcttttcagtcatagtttgatgtatgtgtgttttaactataaagacaagacagct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
41939718 caagatgatgaacatggtggctctgaaattgagcaagaaaatgaatcttttcagtcatagtttgatgtatgtatgttttaactataaagacaagacagct 41939817  T
101 atggacatgttttgcactaattacattggtgact 134  Q
    ||||||||||||||||||||||||||||||||||    
41939818 atggacatgttttgcactaattacattggtgact 41939851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University