View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_low_43 (Length: 376)
Name: NF1104_low_43
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 95 - 287
Target Start/End: Original strand, 49928507 - 49928703
Alignment:
| Q |
95 |
acttggtaggtttaactggttttactattatgttaaattaaatctgcattatctctatatcatgaattatgatgagttttttatattaattttgttgg-- |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49928507 |
acttggtaggtttaactggttttactattatgttaaattaaatctgcattatctctatatcatgaattatgatgagttttttatattaattttgttggtt |
49928606 |
T |
 |
| Q |
193 |
--nnnnnnnnctgtagccttacaacttcatccagataagaacaaacatccaaaagctgaaattgccttcaaacttgtttctgaggttagttttgtca |
287 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49928607 |
ttttttttttctctagccttacaacttcatccagataagaacaaacatccaaaagctgaaattgccttcaaacttgtttctgaggttagttttgtca |
49928703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 327 - 368
Target Start/End: Original strand, 49928740 - 49928781
Alignment:
| Q |
327 |
caagtattgtaacaatggtacaaaatctcatttccctatgct |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49928740 |
caagtattgtaacaatggtacaaaatctcatttccctctgct |
49928781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 205 - 282
Target Start/End: Complemental strand, 13696126 - 13696049
Alignment:
| Q |
205 |
agccttacaacttcatccagataagaacaaacatccaaaagctgaaattgccttcaaacttgtttctgaggttagttt |
282 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||| || ||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
13696126 |
agccttgcaacttcatccagataagaataaacatcccaaggctgaaattgcattcaagcttgtctctgaggttagttt |
13696049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University