View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_low_62 (Length: 320)
Name: NF1104_low_62
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_low_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 30 - 310
Target Start/End: Original strand, 52824117 - 52824397
Alignment:
| Q |
30 |
caagaagcataataggtttcttctaagtgggatcaagctgcactctcctgctcctcctcccactcttcatgaagaaactggtaattttactatatctgag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824117 |
caagaagcataataggtttcttctaagtgggatcaagctgcactctcctgctcctcctcccactcttcatgaagaaactggtaattttactatatctgag |
52824216 |
T |
|
| Q |
130 |
tacttgataaacactatcccaggttggaagtttgaagatttccttgattccccttcttcttctgttccctctcatgaactacaacaccagaatcatatag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824217 |
tacttgataaacactatcccaggttggaagtttgaagatttccttgattccccttcttcttctgttccctctcatgaactacaacaccagaatcatatag |
52824316 |
T |
|
| Q |
230 |
tgcatgatgatgctaattatcatattcatgaggaaaatattctggtttctttctctagcgagagcatgcgtaggatctgtg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824317 |
tgcatgatgatgctaattatcatattcatgaggaaaatattctggtttctttctctagcgagagcatgcgtaggatctgtg |
52824397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University