View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_low_70 (Length: 292)
Name: NF1104_low_70
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 56 - 200
Target Start/End: Complemental strand, 16871759 - 16871618
Alignment:
| Q |
56 |
tgttgccttttaccatcaagcttcattaattaacaagtgcttacatggctgttttattgctattgtgacaagtttttgttggtggtgaaaaatatattgt |
155 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
16871759 |
tgttgcctttttccatcaagcttcgttaattaacaagtgcttaaatggctgttttattgctattgtgacaagtttttgttggttgagaaaaatatattgt |
16871660 |
T |
|
| Q |
156 |
ggcaagttcaaataagcaatatgtattttctaattaatttttact |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16871659 |
ggcaagttca---aagcaatatgtattttctaattaatttttact |
16871618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University