View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_low_81 (Length: 269)
Name: NF1104_low_81
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_low_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 258
Target Start/End: Original strand, 38038224 - 38038490
Alignment:
| Q |
12 |
atgaacatgaagtatgggccttgtatggggatgacgaggctggcacgcttggagcgtgctgtgaagcttggtttgaaccctccagaggaaatcgcggaac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38038224 |
atgaacatgaagtatgggccttgtatggggatgacgaggctggcacgcttggagcgtgctgtgaagcttggtttgaaccctccggaggaaatcgcggaac |
38038323 |
T |
 |
| Q |
112 |
tcttgaagagtggtaaagttcagcaagaatcactttgggacactcgcatttagaacgctgcttaaatgtaataat--------------------cttgt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38038324 |
tcttgaagagtggtaaagttcagcaagaatcactttgggacactcgcatttagaacgctgcttaaatgtaataatcttgttgtagcttcttctgacttgt |
38038423 |
T |
 |
| Q |
192 |
ttgtttgtttaggttttgcttagggaaaatcagtttcttgctgtgtcccctttccctggtagtagta |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38038424 |
ttgtttgtttaggttttgcttagggaaaatcactttcttgctgtgtcccctttccctggtagtagta |
38038490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University