View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_low_90 (Length: 263)
Name: NF1104_low_90
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_low_90 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 42 - 237
Target Start/End: Complemental strand, 6361857 - 6361649
Alignment:
| Q |
42 |
ctgatcaagttttttggccctaaagcgatgatttttcggttccaaaagtttgaattttggcatcaataattgtttgatcacgctaaaagggaataattgt |
141 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6361857 |
ctgatcaagttttttggccctagagcgatgatttt-cggttccaaaagtttgaattttggcatcaataattgtttgatcacgctaaaagggaattattgt |
6361759 |
T |
 |
| Q |
142 |
gctgacaagttagctaagcgcggacattc--------------tttagcgggattctcttcctattttccgctgttcttaattttgcttgggtttcccct |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6361758 |
gctgacaagttagctaagcgcggacattccttgtccggtgctttttagcgggattctcttcctattttccgctgttcttaattttgcttgggtttcccct |
6361659 |
T |
 |
| Q |
228 |
cctcttctct |
237 |
Q |
| |
|
|||||||||| |
|
|
| T |
6361658 |
cctcttctct |
6361649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University