View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_low_97 (Length: 251)
Name: NF1104_low_97
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_low_97 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 20423161 - 20423382
Alignment:
| Q |
1 |
aaatcaataagttttaatcaagcaattggacttatgtgtttaataatcttcaccaaggaataatattcaagagaatgtgagtaggattcttggatggaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20423161 |
aaatcaataagttttaatcaagcaattggacttatgtgtttaataatcttcaccaaggaataatattcaagagaatgtgagtaggattcttggatggaac |
20423260 |
T |
 |
| Q |
101 |
aattattgcctagaatttacttactttttggttgaactcctgattaccaaggcctctttcctttgagaaccagctagttaataccnnnnnnntcaagaag |
200 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20423261 |
aattattgtctaaaatttacttactttttggttaaactcttgattaccaaggcctctttcctttgagaaccagctagttaataccaaaaaaatcaagaag |
20423360 |
T |
 |
| Q |
201 |
ttataatgatttgataaaaatt |
222 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
20423361 |
ttttaatgatttgataaaaatt |
20423382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University