View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1104_low_99 (Length: 251)
Name: NF1104_low_99
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1104_low_99 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 48412761 - 48412817
Alignment:
| Q |
1 |
ctcacaccaaaggaaggtggtttgcgcgggaactcatgacccacaatggcggcaaat |
57 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412761 |
ctcacaacaaaggaaggtggtttgcgcgggaactcatgacccacaatggcggcaaat |
48412817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University