View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11050_low_16 (Length: 276)
Name: NF11050_low_16
Description: NF11050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11050_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 258847 - 259072
Alignment:
| Q |
20 |
caatagctgcagcaactgcagctattcatgggttcagtgaagcatttcataaatacaagccatttaagtataaaatgtagcttaggttttttaggtaagc |
119 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
258847 |
caatagctacagcaactgcagccattcatgggttcagtgaagcatttcataaatacaagccatttaagtataaaatgtagcttaggttttttaggtaagc |
258946 |
T |
|
| Q |
120 |
ttttagcatgtagaagctctaaagttggaatgtttaatggtagattattgcattgtaaaggagaaggaaattttgcatttatttgttttatcttcttatt |
219 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
258947 |
ttttagcatgtagaagctctcaagttggaatgtttaatggtagattattgcattgtaaagatgaaggaaattttgcatttatttgttttatcttcttatt |
259046 |
T |
|
| Q |
220 |
cttgcactccccagtcttctgatttt |
245 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
259047 |
cttgcactccccagtcttctgatttt |
259072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University