View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11050_low_21 (Length: 245)
Name: NF11050_low_21
Description: NF11050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11050_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 40238104 - 40238324
Alignment:
| Q |
16 |
agtaattcatccccttctagctttgatcttttgtggctagctctgtggccacctagtgcttgaaaggatgggaattttttgttgcacgttttgcactcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40238104 |
agtaattcatccccttctagctttgatcttttgtggctagctctgtggccacctagtgcttgaaaggatgggaattttttgttgcacgttttgcactcat |
40238203 |
T |
|
| Q |
116 |
attccactggtgcaaaacttttttgatttggtttattgttttgtggttgatgttggggataagagagcatcattagacaatttgctaaatctatgttttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40238204 |
attccactggtgcaaaacttttttgatttggtttattgttttgtggttgatgttggggataagagagcatcattagacaatttgctaaatctatgttttc |
40238303 |
T |
|
| Q |
216 |
taacccttcgaaatctctctg |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40238304 |
taacccttcgaaatctctctg |
40238324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 46 - 119
Target Start/End: Original strand, 40243780 - 40243853
Alignment:
| Q |
46 |
ttgtggctagctctgtggccacctagtgcttgaaaggatgggaattttttgttgcacgttttgcactcatattc |
119 |
Q |
| |
|
||||||||||| || |||||||| || |||||||| |||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
40243780 |
ttgtggctagccctatggccaccaagggcttgaaaagatgagaattttttgttgcacgttttgcattcatattc |
40243853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University