View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11051_low_1 (Length: 526)

Name: NF11051_low_1
Description: NF11051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11051_low_1
NF11051_low_1
[»] chr2 (83 HSPs)
chr2 (197-518)||(19456701-19457022)
chr2 (197-518)||(21703444-21703765)
chr2 (216-506)||(27434746-27435036)
chr2 (197-518)||(27392630-27392951)
chr2 (7-157)||(19456511-19456661)
chr2 (216-517)||(23128868-23129169)
chr2 (216-517)||(28881852-28882153)
chr2 (7-157)||(21703254-21703404)
chr2 (216-517)||(20837556-20837857)
chr2 (216-517)||(12655180-12655481)
chr2 (7-157)||(34303393-34303543)
chr2 (7-154)||(27392973-27393120)
chr2 (7-157)||(3784655-3784805)
chr2 (7-157)||(16163600-16163750)
chr2 (7-157)||(34157012-34157162)
chr2 (7-157)||(27118689-27118839)
chr2 (35-157)||(31891446-31891568)
chr2 (197-331)||(31891608-31891742)
chr2 (197-331)||(27118515-27118649)
chr2 (207-331)||(3784481-3784605)
chr2 (207-331)||(34156838-34156962)
chr2 (216-331)||(34303602-34303717)
chr2 (207-331)||(16163426-16163550)
chr2 (219-517)||(34279087-34279385)
chr2 (219-466)||(13936849-13937096)
chr2 (219-433)||(21677487-21677701)
chr2 (225-517)||(37374799-37375091)
chr2 (219-466)||(261070-261317)
chr2 (219-517)||(11635494-11635792)
chr2 (219-517)||(11641683-11641981)
chr2 (219-466)||(34286043-34286290)
chr2 (219-466)||(34291103-34291350)
chr2 (252-434)||(12716943-12717125)
chr2 (35-157)||(28882215-28882337)
chr2 (219-466)||(37925182-37925429)
chr2 (35-157)||(12655543-12655665)
chr2 (35-157)||(23128684-23128806)
chr2 (7-157)||(27434534-27434684)
chr2 (14-157)||(11635283-11635426)
chr2 (219-466)||(40233188-40233435)
chr2 (35-157)||(20837919-20838041)
chr2 (35-157)||(21677300-21677422)
chr2 (252-434)||(31876002-31876184)
chr2 (252-434)||(34861401-34861583)
chr2 (252-434)||(37686247-37686429)
chr2 (252-434)||(37701512-37701694)
chr2 (252-434)||(39889783-39889965)
chr2 (219-427)||(32049526-32049734)
chr2 (14-157)||(11641472-11641615)
chr2 (327-466)||(12586490-12586629)
chr2 (14-157)||(22926125-22926268)
chr2 (14-157)||(34279450-34279593)
chr2 (7-154)||(40233515-40233662)
chr2 (252-434)||(16829676-16829858)
chr2 (252-434)||(16891623-16891805)
chr2 (252-457)||(19416837-19417042)
chr2 (252-433)||(22926366-22926547)
chr2 (327-466)||(9350407-9350546)
chr2 (327-466)||(27776896-27777035)
chr2 (327-466)||(27803381-27803520)
chr2 (327-466)||(27816663-27816802)
chr2 (14-157)||(34286355-34286498)
chr2 (14-157)||(34291415-34291558)
chr2 (35-157)||(34861681-34861803)
chr2 (35-157)||(37686027-37686149)
chr2 (35-157)||(37701292-37701414)
chr2 (35-157)||(37925494-37925616)
chr2 (213-466)||(39052127-39052380)
chr2 (35-157)||(31876282-31876404)
chr2 (14-156)||(37375163-37375305)
chr2 (57-154)||(13936684-13936781)
chr2 (35-157)||(16829456-16829578)
chr2 (35-157)||(16891903-16892025)
chr2 (35-157)||(32049799-32049921)
chr2 (35-157)||(39890075-39890197)
chr2 (57-154)||(12716742-12716839)
chr2 (57-154)||(27777226-27777323)
chr2 (57-154)||(27803711-27803808)
chr2 (57-154)||(27816984-27817081)
chr2 (57-154)||(39051962-39052059)
chr2 (14-148)||(260850-260984)
chr2 (57-154)||(9350122-9350219)
chr2 (57-154)||(12586814-12586911)
[»] chr3 (119 HSPs)
chr3 (197-518)||(16626838-16627158)
chr3 (197-518)||(18529999-18530320)
chr3 (216-506)||(15893060-15893350)
chr3 (216-517)||(8301618-8301919)
chr3 (216-517)||(8295578-8295879)
chr3 (216-517)||(18050865-18051166)
chr3 (7-157)||(16626648-16626798)
chr3 (7-157)||(18530354-18530504)
chr3 (216-517)||(4797007-4797308)
chr3 (216-517)||(15741436-15741737)
chr3 (216-517)||(35880369-35880670)
chr3 (7-157)||(4625910-4626060)
chr3 (219-517)||(4721234-4721532)
chr3 (7-157)||(31034259-31034409)
chr3 (7-157)||(32292718-32292868)
chr3 (7-157)||(17993926-17994076)
chr3 (216-517)||(29149109-29149410)
chr3 (7-157)||(5652353-5652503)
chr3 (216-517)||(18330277-18330573)
chr3 (219-517)||(6191919-6192217)
chr3 (208-517)||(8211344-8211653)
chr3 (207-331)||(17994126-17994250)
chr3 (219-517)||(28116314-28116612)
chr3 (216-331)||(4625736-4625851)
chr3 (219-517)||(7072815-7073113)
chr3 (208-517)||(18277398-18277707)
chr3 (208-517)||(18292699-18293008)
chr3 (208-517)||(18308000-18308309)
chr3 (207-331)||(5652179-5652303)
chr3 (208-427)||(20065739-20065958)
chr3 (208-506)||(10395750-10396048)
chr3 (219-517)||(47023056-47023354)
chr3 (252-466)||(22871264-22871478)
chr3 (252-466)||(22886323-22886537)
chr3 (252-433)||(5466672-5466853)
chr3 (252-457)||(5596756-5596961)
chr3 (219-331)||(5713016-5713128)
chr3 (219-331)||(5723926-5724038)
chr3 (219-331)||(5757439-5757551)
chr3 (219-331)||(5768330-5768442)
chr3 (219-469)||(7996213-7996463)
chr3 (219-469)||(10642721-10642971)
chr3 (35-157)||(15892876-15892998)
chr3 (252-434)||(18224877-18225059)
chr3 (228-517)||(21674296-21674585)
chr3 (35-157)||(8295938-8296060)
chr3 (35-157)||(8301437-8301559)
chr3 (252-434)||(17985346-17985528)
chr3 (35-157)||(18330635-18330757)
chr3 (252-434)||(28020964-28021146)
chr3 (219-457)||(36997446-36997684)
chr3 (252-517)||(5013315-5013580)
chr3 (252-505)||(6542864-6543117)
chr3 (14-157)||(4721597-4721740)
chr3 (219-466)||(11110718-11110965)
chr3 (14-157)||(22387727-22387870)
chr3 (252-434)||(4347074-4347256)
chr3 (35-157)||(4796823-4796945)
chr3 (35-157)||(15741264-15741386)
chr3 (35-157)||(17985126-17985248)
chr3 (35-157)||(18051228-18051350)
chr3 (252-466)||(18242381-18242595)
chr3 (35-156)||(6542632-6542753)
chr3 (14-157)||(5609471-5609614)
chr3 (14-157)||(6192282-6192425)
chr3 (14-157)||(18277201-18277344)
chr3 (14-157)||(18292502-18292645)
chr3 (14-157)||(18307803-18307946)
chr3 (327-466)||(20577327-20577466)
chr3 (14-157)||(28339268-28339411)
chr3 (14-157)||(29148904-29149047)
chr3 (14-157)||(31964622-31964765)
chr3 (14-157)||(50134220-50134363)
chr3 (35-157)||(35880732-35880854)
chr3 (327-457)||(51781674-51781804)
chr3 (252-457)||(24327822-24328027)
chr3 (252-433)||(28338989-28339170)
chr3 (252-433)||(31964863-31965044)
chr3 (252-433)||(50134461-50134642)
chr3 (219-403)||(29665342-29665526)
chr3 (14-157)||(4416885-4417028)
chr3 (35-154)||(5713196-5713315)
chr3 (35-154)||(5724106-5724225)
chr3 (35-154)||(5757252-5757371)
chr3 (35-154)||(5768143-5768262)
chr3 (14-157)||(10396099-10396242)
chr3 (14-157)||(28116103-28116246)
chr3 (35-154)||(36997247-36997366)
chr3 (327-433)||(4416603-4416709)
chr3 (35-157)||(7996528-7996650)
chr3 (35-157)||(10643036-10643158)
chr3 (35-157)||(47023419-47023541)
chr3 (208-356)||(22387921-22388069)
chr3 (327-430)||(5609787-5609890)
chr3 (14-157)||(7073178-7073321)
chr3 (14-157)||(21674659-21674802)
chr3 (219-466)||(48465569-48465816)
chr3 (327-457)||(51796762-51796893)
chr3 (208-506)||(32438771-32439069)
chr3 (208-356)||(4892977-4893125)
chr3 (14-154)||(11110498-11110638)
chr3 (14-157)||(4346836-4346979)
chr3 (35-156)||(18242706-18242827)
chr3 (35-155)||(5466953-5467073)
chr3 (14-154)||(48465896-48466036)
chr3 (14-157)||(22871005-22871148)
chr3 (14-157)||(22886064-22886207)
chr3 (14-157)||(28021241-28021384)
chr3 (35-94)||(51782052-51782111)
chr3 (15-157)||(4893176-4893318)
chr3 (35-148)||(5013687-5013800)
chr3 (35-156)||(5596527-5596648)
chr3 (57-154)||(20577039-20577136)
chr3 (57-154)||(29665162-29665259)
chr3 (57-156)||(20066010-20066109)
chr3 (43-94)||(51797141-51797192)
chr3 (14-148)||(8211713-8211847)
chr3 (35-157)||(18225157-18225279)
chr3 (15-157)||(32439120-32439262)
[»] chr1 (14 HSPs)
chr1 (197-518)||(20460748-20461069)
chr1 (197-518)||(16208319-16208640)
chr1 (14-157)||(20461085-20461228)
chr1 (7-157)||(16208132-16208282)
chr1 (7-157)||(20340436-20340586)
chr1 (7-157)||(28151866-28152016)
chr1 (197-331)||(20340626-20340760)
chr1 (219-517)||(41793624-41793922)
chr1 (252-466)||(10962362-10962576)
chr1 (252-466)||(51637910-51638124)
chr1 (14-157)||(41793416-41793559)
chr1 (252-457)||(28584682-28584887)
chr1 (35-157)||(28584985-28585107)
chr1 (35-157)||(10962674-10962796)
[»] chr4 (50 HSPs)
chr4 (197-516)||(15285219-15285538)
chr4 (197-518)||(15227529-15227850)
chr4 (197-518)||(1899916-1900237)
chr4 (197-518)||(14235819-14236140)
chr4 (216-517)||(14664675-14664976)
chr4 (7-157)||(15227890-15228040)
chr4 (7-157)||(15285029-15285179)
chr4 (216-517)||(17013657-17013958)
chr4 (7-157)||(1900277-1900427)
chr4 (221-518)||(15391650-15391948)
chr4 (216-517)||(24592624-24592925)
chr4 (7-157)||(24460706-24460856)
chr4 (7-154)||(15391439-15391586)
chr4 (7-157)||(14235626-14235776)
chr4 (216-517)||(6569510-6569811)
chr4 (207-331)||(24460906-24461030)
chr4 (208-517)||(14763609-14763918)
chr4 (208-517)||(36344817-36345126)
chr4 (235-517)||(19372918-19373200)
chr4 (219-517)||(27163633-27163931)
chr4 (225-466)||(54833098-54833339)
chr4 (219-517)||(5005527-5005825)
chr4 (252-517)||(14098198-14098463)
chr4 (14-157)||(17014020-17014163)
chr4 (219-434)||(30753482-30753697)
chr4 (252-434)||(31126867-31127049)
chr4 (252-457)||(18800971-18801176)
chr4 (14-157)||(14763412-14763555)
chr4 (35-157)||(24592443-24592565)
chr4 (219-457)||(33674126-33674364)
chr4 (252-505)||(40105987-40106240)
chr4 (219-434)||(21969441-21969656)
chr4 (35-157)||(14098561-14098683)
chr4 (35-157)||(14665038-14665160)
chr4 (14-157)||(5005893-5006036)
chr4 (14-157)||(6569873-6570016)
chr4 (35-157)||(27163446-27163568)
chr4 (35-156)||(18800742-18800863)
chr4 (35-154)||(30753777-30753896)
chr4 (327-466)||(39850331-39850470)
chr4 (35-157)||(31126647-31126769)
chr4 (14-154)||(33673906-33674046)
chr4 (14-156)||(36344623-36344765)
chr4 (35-157)||(40105767-40105889)
chr4 (208-356)||(24112483-24112631)
chr4 (208-356)||(34189262-34189410)
chr4 (15-157)||(24112682-24112824)
chr4 (15-157)||(34189069-34189211)
chr4 (14-156)||(54833408-54833550)
chr4 (57-154)||(39850661-39850758)
[»] scaffold0124 (4 HSPs)
scaffold0124 (197-518)||(20053-20374)
scaffold0124 (7-157)||(20393-20543)
scaffold0124 (216-517)||(30095-30396)
scaffold0124 (35-82)||(30532-30579)
[»] chr7 (63 HSPs)
chr7 (197-506)||(16040980-16041289)
chr7 (200-518)||(16450178-16450496)
chr7 (216-517)||(16518615-16518916)
chr7 (216-517)||(16503579-16503880)
chr7 (7-157)||(16449985-16450135)
chr7 (7-157)||(16041329-16041479)
chr7 (216-517)||(2154216-2154517)
chr7 (216-517)||(5127635-5127936)
chr7 (7-157)||(26484700-26484850)
chr7 (216-517)||(10917064-10917365)
chr7 (7-157)||(2108992-2109142)
chr7 (7-157)||(2775365-2775515)
chr7 (7-157)||(31088451-31088601)
chr7 (7-157)||(39211010-39211160)
chr7 (216-517)||(11424975-11425276)
chr7 (7-157)||(45733466-45733616)
chr7 (15-157)||(18540805-18540947)
chr7 (207-331)||(31088651-31088775)
chr7 (207-331)||(45733292-45733416)
chr7 (219-469)||(45387034-45387284)
chr7 (219-517)||(5147542-5147840)
chr7 (219-517)||(16736662-16736960)
chr7 (219-517)||(16751716-16752014)
chr7 (219-517)||(17523175-17523473)
chr7 (219-517)||(17529742-17530040)
chr7 (252-517)||(31124554-31124819)
chr7 (35-157)||(11424791-11424913)
chr7 (219-457)||(11441263-11441501)
chr7 (208-433)||(4145314-4145539)
chr7 (252-517)||(24592776-24593041)
chr7 (14-157)||(5127998-5128141)
chr7 (252-466)||(9618345-9618559)
chr7 (35-157)||(10916883-10917005)
chr7 (35-157)||(16503395-16503517)
chr7 (35-157)||(16518431-16518553)
chr7 (252-434)||(26275329-26275511)
chr7 (219-517)||(26434900-26435198)
chr7 (252-432)||(26320104-26320284)
chr7 (14-157)||(5147334-5147477)
chr7 (327-434)||(3445020-3445127)
chr7 (219-434)||(26485946-26486161)
chr7 (35-157)||(2154579-2154701)
chr7 (14-157)||(16736454-16736597)
chr7 (14-157)||(16751508-16751651)
chr7 (14-157)||(17523538-17523681)
chr7 (14-157)||(17529534-17529677)
chr7 (219-466)||(26538075-26538322)
chr7 (35-157)||(4145138-4145260)
chr7 (35-157)||(9618657-9618779)
chr7 (35-157)||(26275109-26275231)
chr7 (35-157)||(26319884-26320006)
chr7 (252-466)||(26670149-26670363)
chr7 (35-157)||(45387349-45387471)
chr7 (208-356)||(5159326-5159474)
chr7 (35-154)||(3445315-3445434)
chr7 (14-157)||(26435263-26435406)
chr7 (327-434)||(31564709-31564816)
chr7 (35-157)||(26669929-26670051)
chr7 (35-156)||(31564405-31564526)
chr7 (35-154)||(26537885-26538004)
chr7 (35-148)||(11441587-11441700)
chr7 (35-156)||(31124927-31125048)
chr7 (15-157)||(5159525-5159667)
[»] chr5 (100 HSPs)
chr5 (197-519)||(23891855-23892177)
chr5 (197-518)||(25198682-25199003)
chr5 (216-517)||(24688367-24688668)
chr5 (216-517)||(23752660-23752961)
chr5 (216-517)||(30934287-30934588)
chr5 (7-157)||(22888484-22888634)
chr5 (7-157)||(25199043-25199193)
chr5 (216-517)||(23718198-23718500)
chr5 (323-517)||(24951761-24951955)
chr5 (216-517)||(11549005-11549306)
chr5 (197-354)||(22888287-22888444)
chr5 (7-157)||(23892220-23892370)
chr5 (216-517)||(33777138-33777439)
chr5 (216-516)||(22999324-22999624)
chr5 (7-157)||(13184646-13184796)
chr5 (7-157)||(33877261-33877411)
chr5 (7-157)||(11325808-11325958)
chr5 (7-157)||(13440492-13440642)
chr5 (7-157)||(29889080-29889230)
chr5 (207-331)||(13184846-13184970)
chr5 (207-331)||(13440692-13440816)
chr5 (207-331)||(33877087-33877211)
chr5 (219-466)||(9548756-9549003)
chr5 (197-331)||(11325634-11325768)
chr5 (219-517)||(15658973-15659271)
chr5 (219-457)||(41674420-41674658)
chr5 (219-466)||(31431130-31431377)
chr5 (252-466)||(2510753-2510967)
chr5 (219-433)||(8665688-8665902)
chr5 (14-157)||(23752455-23752598)
chr5 (219-466)||(30168171-30168418)
chr5 (252-466)||(9317153-9317367)
chr5 (35-157)||(11549368-11549490)
chr5 (35-157)||(23718014-23718136)
chr5 (252-434)||(24681171-24681353)
chr5 (252-434)||(24723698-24723880)
chr5 (35-157)||(30934647-30934769)
chr5 (327-505)||(40473873-40474051)
chr5 (219-517)||(43077900-43078198)
chr5 (252-517)||(18375658-18375923)
chr5 (219-466)||(18500961-18501208)
chr5 (219-517)||(3789177-3789475)
chr5 (252-434)||(12131889-12132071)
chr5 (35-157)||(24688183-24688305)
chr5 (216-314)||(24969878-24969976)
chr5 (35-157)||(24970032-24970154)
chr5 (252-434)||(37771245-37771427)
chr5 (252-517)||(5637561-5637826)
chr5 (252-469)||(15759103-15759320)
chr5 (252-517)||(30151669-30151934)
chr5 (252-505)||(37358901-37359154)
chr5 (327-466)||(6874004-6874143)
chr5 (14-157)||(33777501-33777644)
chr5 (35-157)||(2511065-2511187)
chr5 (35-157)||(8665501-8665623)
chr5 (35-157)||(15758883-15759005)
chr5 (252-466)||(26480094-26480308)
chr5 (252-434)||(31826665-31826847)
chr5 (252-434)||(33516090-33516272)
chr5 (252-466)||(34616223-34616437)
chr5 (252-434)||(37671738-37671920)
chr5 (14-157)||(6874319-6874462)
chr5 (14-157)||(9548548-9548691)
chr5 (14-157)||(22999119-22999262)
chr5 (327-466)||(37754670-37754809)
chr5 (35-157)||(26480406-26480528)
chr5 (252-434)||(32599715-32599897)
chr5 (14-156)||(37671488-37671630)
chr5 (14-157)||(15658765-15658908)
chr5 (14-157)||(41674723-41674866)
chr5 (35-157)||(5637924-5638046)
chr5 (35-157)||(9317465-9317587)
chr5 (35-157)||(12132169-12132291)
chr5 (14-156)||(18500735-18500877)
chr5 (14-156)||(28649250-28649392)
chr5 (252-434)||(28960044-28960226)
chr5 (35-157)||(30152032-30152154)
chr5 (35-157)||(30168483-30168605)
chr5 (35-157)||(34616532-34616654)
chr5 (252-457)||(28648937-28649142)
chr5 (252-457)||(29967312-29967517)
chr5 (252-457)||(30029126-30029331)
chr5 (35-148)||(31431463-31431576)
chr5 (327-466)||(13325165-13325304)
chr5 (35-154)||(31826433-31826552)
chr5 (35-157)||(18375438-18375560)
chr5 (35-157)||(28959812-28959934)
chr5 (14-156)||(37770992-37771134)
chr5 (35-156)||(37358669-37358790)
chr5 (208-356)||(33292340-33292488)
chr5 (14-157)||(32599477-32599620)
chr5 (35-156)||(3789556-3789677)
chr5 (35-156)||(37754995-37755116)
chr5 (14-154)||(43078269-43078409)
chr5 (15-157)||(33292539-33292681)
chr5 (35-157)||(33516370-33516492)
chr5 (57-154)||(24681457-24681554)
chr5 (57-154)||(24723984-24724081)
chr5 (57-154)||(40473597-40473694)
chr5 (15-156)||(13324835-13324976)
[»] chr8 (43 HSPs)
chr8 (216-517)||(16283091-16283392)
chr8 (216-517)||(16277196-16277497)
chr8 (216-517)||(19687740-19688041)
chr8 (197-518)||(22081125-22081446)
chr8 (216-517)||(2137531-2137832)
chr8 (216-517)||(14557269-14557570)
chr8 (216-517)||(27609177-27609478)
chr8 (7-157)||(44563106-44563256)
chr8 (7-157)||(9354627-9354777)
chr8 (7-157)||(19659099-19659249)
chr8 (7-154)||(22080938-22081085)
chr8 (7-157)||(33244670-33244820)
chr8 (207-331)||(19659299-19659423)
chr8 (216-331)||(44562932-44563047)
chr8 (207-331)||(9354453-9354577)
chr8 (219-517)||(18710228-18710526)
chr8 (219-517)||(19674080-19674378)
chr8 (225-466)||(19286158-19286399)
chr8 (7-157)||(16283454-16283604)
chr8 (219-457)||(31490025-31490263)
chr8 (35-157)||(16277559-16277681)
chr8 (208-433)||(31354250-31354475)
chr8 (35-157)||(2137347-2137469)
chr8 (35-157)||(19688103-19688225)
chr8 (35-157)||(27608993-27609115)
chr8 (14-157)||(31354529-31354672)
chr8 (35-157)||(14557629-14557751)
chr8 (252-434)||(19208668-19208850)
chr8 (252-466)||(28362263-28362477)
chr8 (252-505)||(3329827-3330080)
chr8 (252-505)||(29828967-29829220)
chr8 (35-157)||(19208448-19208570)
chr8 (252-466)||(19518451-19518665)
chr8 (35-157)||(31489838-31489960)
chr8 (252-457)||(33258425-33258630)
chr8 (14-157)||(19674446-19674589)
chr8 (35-157)||(28362043-28362165)
chr8 (35-156)||(3329595-3329716)
chr8 (14-157)||(18710591-18710734)
chr8 (252-517)||(12093041-12093306)
chr8 (35-156)||(12092812-12092933)
chr8 (14-156)||(19286468-19286610)
chr8 (34-156)||(29829328-29829450)
[»] scaffold0089 (6 HSPs)
scaffold0089 (216-517)||(29405-29706)
scaffold0089 (219-517)||(40385-40683)
scaffold0089 (216-517)||(47298-47599)
scaffold0089 (35-157)||(29768-29890)
scaffold0089 (35-157)||(40198-40320)
scaffold0089 (35-157)||(47114-47236)
[»] scaffold0109 (2 HSPs)
scaffold0109 (197-518)||(21208-21529)
scaffold0109 (7-154)||(21569-21716)
[»] scaffold0143 (2 HSPs)
scaffold0143 (216-517)||(26934-27235)
scaffold0143 (35-157)||(27297-27419)
[»] chr6 (88 HSPs)
chr6 (210-518)||(20160345-20160650)
chr6 (210-518)||(22172181-22172486)
chr6 (216-517)||(13299207-13299508)
chr6 (216-517)||(24863356-24863657)
chr6 (216-517)||(15424573-15424874)
chr6 (219-517)||(22935136-22935434)
chr6 (219-517)||(23857581-23857879)
chr6 (216-517)||(26988640-26988941)
chr6 (216-517)||(26999712-27000013)
chr6 (7-157)||(22456978-22457128)
chr6 (7-157)||(22477317-22477467)
chr6 (216-466)||(24304874-24305124)
chr6 (7-157)||(27290414-27290564)
chr6 (216-517)||(16749493-16749794)
chr6 (216-360)||(22477529-22477673)
chr6 (219-466)||(26918070-26918317)
chr6 (7-157)||(8892354-8892504)
chr6 (7-157)||(8903589-8903739)
chr6 (7-157)||(13522117-13522267)
chr6 (7-157)||(14143329-14143479)
chr6 (7-157)||(26787946-26788096)
chr6 (7-157)||(27196319-27196469)
chr6 (7-157)||(27252771-27252921)
chr6 (7-157)||(33374300-33374450)
chr6 (7-157)||(28162659-28162809)
chr6 (197-331)||(28162485-28162619)
chr6 (207-331)||(13522317-13522441)
chr6 (207-331)||(33374500-33374624)
chr6 (9-156)||(20160704-20160851)
chr6 (9-156)||(22171980-22172127)
chr6 (197-331)||(8892544-8892678)
chr6 (197-331)||(8903779-8903913)
chr6 (208-517)||(29549117-29549426)
chr6 (7-157)||(22934924-22935074)
chr6 (7-157)||(23857369-23857519)
chr6 (208-517)||(27044029-27044338)
chr6 (7-154)||(27272624-27272771)
chr6 (219-517)||(3695702-3696000)
chr6 (14-157)||(26918382-26918525)
chr6 (248-434)||(4525011-4525197)
chr6 (35-157)||(13299023-13299145)
chr6 (35-157)||(24304690-24304812)
chr6 (35-157)||(26989003-26989125)
chr6 (252-517)||(17024901-17025166)
chr6 (14-157)||(16749856-16749999)
chr6 (35-157)||(15424389-15424511)
chr6 (35-157)||(24863719-24863841)
chr6 (35-157)||(27000075-27000197)
chr6 (252-466)||(27484807-27485021)
chr6 (252-466)||(29501096-29501310)
chr6 (252-434)||(29572735-29572917)
chr6 (252-434)||(30558308-30558490)
chr6 (327-434)||(4757483-4757590)
chr6 (327-466)||(4772687-4772826)
chr6 (327-466)||(27007402-27007541)
chr6 (219-466)||(34463620-34463867)
chr6 (35-156)||(4525289-4525410)
chr6 (252-517)||(4546076-4546341)
chr6 (252-457)||(16944319-16944524)
chr6 (252-433)||(26777919-26778100)
chr6 (252-517)||(28207081-28207346)
chr6 (14-157)||(29549477-29549620)
chr6 (35-156)||(4773009-4773130)
chr6 (35-154)||(3696086-3696205)
chr6 (219-466)||(16673817-16674064)
chr6 (327-434)||(27360377-27360484)
chr6 (327-434)||(27450720-27450827)
chr6 (35-157)||(29573015-29573137)
chr6 (35-148)||(4545847-4545960)
chr6 (35-148)||(4724206-4724319)
chr6 (252-505)||(4724435-4724688)
chr6 (35-156)||(4757767-4757888)
chr6 (35-148)||(28207465-28207578)
chr6 (14-154)||(16674144-16674284)
chr6 (14-154)||(34463397-34463537)
chr6 (14-156)||(27007730-27007872)
chr6 (14-156)||(27044390-27044532)
chr6 (219-505)||(27629968-27630254)
chr6 (333-434)||(26116792-26116893)
chr6 (35-156)||(27485132-27485253)
chr6 (35-157)||(26777687-26777809)
chr6 (35-157)||(30558088-30558210)
chr6 (35-156)||(26116482-26116603)
chr6 (35-156)||(27360064-27360185)
chr6 (35-156)||(27450407-27450528)
chr6 (35-156)||(29501418-29501539)
chr6 (57-156)||(17025280-17025379)
chr6 (324-505)||(27272947-27273128)
[»] scaffold0558 (1 HSPs)
scaffold0558 (7-157)||(129-279)
[»] scaffold0260 (2 HSPs)
scaffold0260 (7-157)||(2759-2909)
scaffold0260 (197-331)||(2949-3083)
[»] scaffold0029 (2 HSPs)
scaffold0029 (216-517)||(443-744)
scaffold0029 (35-157)||(258-381)
[»] scaffold0415 (3 HSPs)
scaffold0415 (7-92)||(2018-2103)
scaffold0415 (219-466)||(5682-5930)
scaffold0415 (14-94)||(6080-6160)
[»] scaffold0336 (2 HSPs)
scaffold0336 (248-517)||(7874-8143)
scaffold0336 (14-157)||(9571-9714)
[»] scaffold0099 (1 HSPs)
scaffold0099 (323-517)||(48568-48769)
[»] scaffold0237 (2 HSPs)
scaffold0237 (252-517)||(15279-15544)
scaffold0237 (35-157)||(15059-15181)
[»] scaffold0144 (2 HSPs)
scaffold0144 (252-517)||(26551-26816)
scaffold0144 (42-157)||(26338-26453)
[»] scaffold0350 (2 HSPs)
scaffold0350 (252-434)||(7588-7770)
scaffold0350 (35-157)||(7368-7490)
[»] scaffold0159 (3 HSPs)
scaffold0159 (35-157)||(9195-9317)
scaffold0159 (35-157)||(20020-20142)
scaffold0159 (252-430)||(9415-9593)
[»] scaffold0038 (2 HSPs)
scaffold0038 (252-517)||(7579-7844)
scaffold0038 (35-148)||(7963-8076)
[»] scaffold0496 (1 HSPs)
scaffold0496 (327-367)||(157-197)


Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 83)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 197 - 518
Target Start/End: Original strand, 19456701 - 19457022
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  19456701 catttgctaaacgatggcattaacgggcacctgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgaaagtattgc 19456800  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  19456801 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatccctacttctgtttctt 19456900  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||    
T  19456901 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgacagcttcttctaggcg 19457000  T
Q  497 agtccccatgatgtccatctca 518  Q
    |||||||||| || ||||||||    
T  19457001 agtccccatggtgaccatctca 19457022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 197 - 518
Target Start/End: Original strand, 21703444 - 21703765
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||| | ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||| ||    
T  21703444 catttgttgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 21703543  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||| ||||||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21703544 gcatatgggtacgacggaggtaactaggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 21703643  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    ||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  21703644 tcttcttatgatgaccgttaccgtatctctttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacg 21703743  T
Q  497 agtccccatgatgtccatctca 518  Q
    |||||||||| || ||||||||    
T  21703744 agtccccatggtgaccatctca 21703765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 216 - 506
Target Start/End: Original strand, 27434746 - 27435036
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| | ||| |||||||||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||     
T  27434746 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggtggaaagaaaggatgctgagagtacggcgcatatgggtacgacggag 27434845  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  27434846 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 27434945  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 506  Q
    ||| |||||||||||||||||  | ||||||||| |||| ||||| ||||| || ||||||||||  |||||||| |||||||| ||||||    
T  27434946 accatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatg 27435036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 197 - 518
Target Start/End: Complemental strand, 27392951 - 27392630
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| | | ||||| || ||||||||||||||| ||||||  ||| | |||||||| |||||||||||||| ||||||||||||||||||||||||    
T  27392951 catttgctgagcaatggcattgacgggtacctgaggttgacccggcggtggcggatactggtgatagaatggtgggaagaaaggatgctgagagtattgc 27392852  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
       ||| ||||||  |||  || ||| |||||||  || ||||||||||||||||  ||||||| || ||||||||||||||||||||||||||| ||||    
T  27392851 atgtactggtacggtggaggtagctgagcagcatcgatgggggcaacagtagccacagattgactggttccggcagataccatccctacttctgtctctt 27392752  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||||| ||||| ||| || ||||||||||||| ||||||||| ||||||| || ||||||||||| ||||||| ||| |||||||  ||    
T  27392751 tcttcttatgatgaccattaccatacttccttgatgcatttgcagaggattcacctttctcaaacacaataatgccgtctctgacagcctcttctaagcg 27392652  T
Q  497 agtccccatgatgtccatctca 518  Q
     || |||||| || ||||||||    
T  27392651 ggttcccatggtgaccatctca 27392630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 19456511 - 19456661
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  19456511 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctatgagaagtagagt 19456610  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  19456611 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 19456661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 23128868 - 23129169
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  ||||||| ||||| ||||||     
T  23128868 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 23128967  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || |||||    
T  23128968 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccgtt 23129067  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  23129068 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 23129167  T
Q  516 tc 517  Q
    ||    
T  23129168 tc 23129169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 28882153 - 28881852
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  28882153 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 28882054  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  28882053 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 28881954  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || |||| ||||||||| |||||||| |||||| || |||||    
T  28881953 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacagcttcttccagacgagttcccatggtgaccatc 28881854  T
Q  516 tc 517  Q
    ||    
T  28881853 tc 28881852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 21703254 - 21703404
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  21703254 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgtcctgtctggttgtgcagtgccctctgagaagtagagt 21703353  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||| ||||| | ||||||||||||||| || |||||||||||    
T  21703354 cgggagtaactcagcatacaacattggtatcggagggaaggtaggtctagc 21703404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 20837857 - 20837556
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| || || ||||||||||| ||||| |||||||||||||||||||| ||  ||||||| ||||| ||||||     
T  20837857 ttaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtaggacggat 20837758  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| |||||||||||||||||||||||||||||| | || ||||| |||||||| |||||||||||||| || || || ||    
T  20837757 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccgactgacaccattcctacttccgtttctttcttcttgtggtgtccatt 20837658  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | | ||||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| |||||| || |||||    
T  20837657 accatacctctttgatgcattcacagtggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttcccatggtgaccatc 20837558  T
Q  516 tc 517  Q
    ||    
T  20837557 tc 20837556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 12655481 - 12655180
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| || || ||||||||||| ||||| |||||||||||||||||||| ||  ||||||| ||||| ||||||     
T  12655481 ttaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtaggacggag 12655382  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| |||||||||||||||||||||||||||||| | || ||||| |||||||| |||||||||||||| || || || ||    
T  12655381 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccgactgacaccattcctacttccgtttctttcttcttgtggtgtccatt 12655282  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | |||| |||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  12655281 accatacctctttgatgcattcacagagggttcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 12655182  T
Q  516 tc 517  Q
    ||    
T  12655181 tc 12655180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 34303393 - 34303543
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  34303393 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 34303492  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  34303493 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 34303543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 7 - 154
Target Start/End: Complemental strand, 27393120 - 27392973
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||| | |||    
T  27393120 gatggaaatcgcacttgaggtcagaatggaacctgggaggcaacgggttaggtggaggcttgccctgcctggttgtgcagtgccctttgagaagcaaagt 27393021  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    |||||| | ||||||||| | |||||||||||||||||| ||||||||    
T  27393020 cgggagcagctcggcatacatcattggtatcggaggaaaggtaggtct 27392973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 3784805 - 3784655
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  3784805 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 3784706  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  3784705 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 3784655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 16163750 - 16163600
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  16163750 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 16163651  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  16163650 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 16163600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 34157162 - 34157012
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  34157162 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 34157063  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  34157062 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 34157012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 27118839 - 27118689
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  27118839 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 27118740  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||| | ||| ||||||||||| || |||||||||||    
T  27118739 cgggagtaattcagcatacaacatcggtatcggagggaaggtaggtctagc 27118689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 31891446 - 31891568
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||| |||||||    
T  31891446 gaaccttggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagtaattcagcatataacattggt 31891545  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    ||| ||||||| |||||||||||    
T  31891546 atcagaggaaaggtaggtctagc 31891568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 197 - 331
Target Start/End: Original strand, 31891608 - 31891742
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||| ||| ||||| ||| |||||||||||||||||| | |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||    
T  31891608 cattcgctgaacgacggcattaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 31891707  T
Q  297 gcatacgggtacgacggaaataactgggcagcatt 331  Q
    ||||||||||||||||||  || ||| ||||||||    
T  31891708 gcatacgggtacgacggaggtagctgagcagcatt 31891742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 197 - 331
Target Start/End: Complemental strand, 27118649 - 27118515
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||| ||| ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||    
T  27118649 cattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 27118550  T
Q  297 gcatacgggtacgacggaaataactgggcagcatt 331  Q
    |||| |||||||||||||  || ||| ||||||||    
T  27118549 gcatgcgggtacgacggaggtagctgagcagcatt 27118515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Complemental strand, 3784605 - 3784481
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  3784605 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 3784506  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  3784505 acgacggaggtagctgagcagcatt 3784481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Complemental strand, 34156962 - 34156838
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  34156962 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 34156863  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  34156862 acgacggaggtagctgagcagcatt 34156838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 216 - 331
Target Start/End: Original strand, 34303602 - 34303717
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||     
T  34303602 ttaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggag 34303701  T
Q  316 ataactgggcagcatt 331  Q
     || ||| ||||||||    
T  34303702 gtagctgagcagcatt 34303717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 207 - 331
Target Start/End: Complemental strand, 16163550 - 16163426
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | || ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  16163550 acgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 16163451  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  16163450 acgacggaggtagctgagcagcatt 16163426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 34279385 - 34279087
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  34279385 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 34279286  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  34279285 tttgagctgcattgataggagcaacagtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 34279186  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| || | |||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  34279185 atacctcttcgacgtattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 34279087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 219 - 466
Target Start/End: Original strand, 13936849 - 13937096
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  13936849 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 13936948  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  13936949 tttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 13937048  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  13937049 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 13937096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 219 - 433
Target Start/End: Original strand, 21677487 - 21677701
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  ||  ||| ||||| | ||||   |    
T  21677487 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 21677586  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  21677587 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 21677686  T
Q  419 gtacctctttgatgc 433  Q
     |||||||| |||||    
T  21677687 atacctcttcgatgc 21677701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 225 - 517
Target Start/End: Complemental strand, 37375091 - 37374799
Alignment:
Q  225 acctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactggg 324  Q
    ||||||||| | |||| ||| | ||| ||||||||||| || || || ||||| ||||||||||||||  || |||| ||||| ||||||   |  || |    
T  37375091 acctgaggttggcccggtggcaaagggtactgatgataaaacggcgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgag 37374992  T
Q  325 cagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacct 424  Q
      || || ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||    
T  37374991 ttgcgttgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacct 37374892  T
Q  425 ctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    ||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  37374891 cttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 37374799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 219 - 466
Target Start/End: Original strand, 261070 - 261317
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||||| ||  ||   || ||||| ||||||   |    
T  261070 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 261169  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  261170 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 261269  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     |||||||| ||||||||  | ||||||||| ||||||| || |||||    
T  261270 atacctcttcgatgcattcacagaggattcagctttctcaaacacaat 261317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 11635494 - 11635792
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  11635494 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 11635593  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| | |||||||||||| || || || |||||    
T  11635594 tttgagctgcattgataggagcaacggtagccatggattgaccggctcctgctgacaccatccccacttccgcttctttcttcttgtggtgtccattacc 11635693  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     ||||||||  | ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  11635694 atacctcttcaacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 11635792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 11641683 - 11641981
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  11641683 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 11641782  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| | |||||||||||| || || || |||||    
T  11641783 tttgagctgcattgataggagcaacggtagccatggattgaccggctcctgctgacaccatccccacttccgcttctttcttcttgtggtgtccattacc 11641882  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     ||||||||  | ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  11641883 atacctcttcaacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 11641981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 219 - 466
Target Start/End: Complemental strand, 34286290 - 34286043
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||||||  ||||| |||||| ||| ||||| |||||||| || ||||| ||||||||||||||||| || ||  ||  ||| ||||| ||||||   |    
T  34286290 acgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgggaatacggcatatatgggtatgacggaggca 34286191  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||| ||||||||||||||||||||  | || |||||||||||||| |||||||||||||| || || || |||||    
T  34286190 tttgagccgcattgataggagcaacagtggccatggattgaccggctccacctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 34286091  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
T  34286090 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 34286043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 219 - 466
Target Start/End: Complemental strand, 34291350 - 34291103
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||||||  ||||| |||||| ||| ||||| |||||||| || ||||| ||||||||||||||||| || ||  ||  ||| ||||| ||||||   |    
T  34291350 acgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgggaatacggcatatatgggtatgacggaggca 34291251  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||| ||||||||||||||||||||  | || |||||||||||||| |||||||||||||| || || || |||||    
T  34291250 tttgagccgcattgataggagcaacagtggccatggattgaccggctccacctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 34291151  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
T  34291150 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 34291103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 12716943 - 12717125
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  12716943 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 12717042  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  12717043 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 12717125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 28882337 - 28882215
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28882337 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 28882238  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  28882237 atcggagggaaagtaggtctagc 28882215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 219 - 466
Target Start/End: Complemental strand, 37925429 - 37925182
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
T  37925429 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggca 37925330  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  37925329 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 37925230  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
T  37925229 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 37925182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 12655665 - 12655543
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  12655665 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 12655566  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  12655565 atcggagggaaagtaggtctagc 12655543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 23128684 - 23128806
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  23128684 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 23128783  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  23128784 atcggagggaaagtaggtctagc 23128806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 27434534 - 27434684
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||| ||   |||| ||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||     
T  27434534 gatggaaatcacatttgaggtcggacctgaacttgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagc 27434633  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||| || ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  27434634 cggaagcaactcagcatacaacatcggtatcggagggaaagtaggtctagc 27434684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 11635283 - 11635426
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  11635283 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 11635382  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  11635383 aactcagcatataacatcggtatcggagggaaagtaggtctagc 11635426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 219 - 466
Target Start/End: Complemental strand, 40233435 - 40233188
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
T  40233435 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 40233336  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  40233335 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 40233236  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  40233235 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 40233188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 20838041 - 20837919
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||||||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  20838041 gaacctgggaggcaacagatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 20837942  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  20837941 atcggagggaaagtaggtctagc 20837919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 21677300 - 21677422
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  21677300 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 21677399  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  21677400 atcggagggaaagtaggcctagc 21677422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 31876184 - 31876002
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  31876184 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 31876085  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
T  31876084 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 31876002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 34861583 - 34861401
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  34861583 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 34861484  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
T  34861483 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 34861401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 37686247 - 37686429
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  37686247 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 37686346  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
T  37686347 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 37686429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 37701512 - 37701694
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  37701512 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 37701611  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
T  37701612 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 37701694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 39889965 - 39889783
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||| ||||    
T  39889965 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtggcca 39889866  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  39889865 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 39889783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 219 - 427
Target Start/End: Complemental strand, 32049734 - 32049526
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| | ||||   |    
T  32049734 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 32049635  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||| ||||| || || || |||||    
T  32049634 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttcttttttcttgtggtgtccattacc 32049535  T
Q  419 gtacctctt 427  Q
     ||||||||    
T  32049534 atacctctt 32049526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 11641472 - 11641615
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  11641472 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 11641571  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| |||  |||||||||| ||||||||||||||    
T  11641572 aactcagcatataacatctgtatcggagggaaagtaggtctagc 11641615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 327 - 466
Target Start/End: Complemental strand, 12586629 - 12586490
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||| |||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  12586629 gcattgataggagcaacagtagtcatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 12586530  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  12586529 tcgacgcattcacagaggattcagctttctcaaacacaat 12586490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 22926125 - 22926268
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  22926125 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 22926224  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  22926225 aactcagcatataacatcggtatcggagggaaagtaggcctagc 22926268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 34279593 - 34279450
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34279593 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34279494  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  34279493 aactcagcatataacatcggtatcggagggaaagtaggtctagc 34279450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 7 - 154
Target Start/End: Complemental strand, 40233662 - 40233515
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| |||    
T  40233662 gatggaaatcacatttgaggtcagaccggaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagt 40233563  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
     || || | ||| ||||| | ||||||||| ||||||||||| |||||    
T  40233562 tggaagaagctcagcatacaacattggtataggaggaaaagttggtct 40233515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 16829676 - 16829858
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || |  ||||| || || ||||| |||||||    
T  16829676 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagttgcattgatgggagcaacggtagcca 16829775  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  16829776 tggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 16829858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 16891805 - 16891623
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || |  ||||| || || ||||| |||||||    
T  16891805 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagttgcattgatgggagcaacggtagcca 16891706  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  16891705 tggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 16891623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 457
Target Start/End: Original strand, 19416837 - 19417042
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  19416837 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagccgcattgataggagcaacagtagcca 19416936  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  19416937 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 19417036  T
Q  452 tttctc 457  Q
    ||||||    
T  19417037 tttctc 19417042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 433
Target Start/End: Original strand, 22926366 - 22926547
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| || || |||||||    
T  22926366 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcgacggtagcca 22926465  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 433  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
T  22926466 tggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 22926547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 327 - 466
Target Start/End: Original strand, 9350407 - 9350546
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  9350407 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 9350506  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  9350507 tcgacgcattcacagaggattcagctttctcaaacacaat 9350546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 327 - 466
Target Start/End: Complemental strand, 27777035 - 27776896
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27777035 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27776936  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  27776935 tcgacgcattcacagaggattcagctttctcaaacacaat 27776896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 327 - 466
Target Start/End: Complemental strand, 27803520 - 27803381
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27803520 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27803421  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  27803420 tcgacgcattcacagaggattcagctttctcaaacacaat 27803381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 327 - 466
Target Start/End: Complemental strand, 27816802 - 27816663
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27816802 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27816703  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  27816702 tcgacgcattcacagaggattcagctttctcaaacacaat 27816663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 34286498 - 34286355
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34286498 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34286399  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
T  34286398 aactcagcatataacatcggtattggagggaaagtaggtctagc 34286355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 34291558 - 34291415
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34291558 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34291459  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
T  34291458 aactcagcatataacatcggtattggagggaaagtaggtctagc 34291415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 34861803 - 34861681
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  34861803 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 34861704  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  34861703 atcggagggaaagtaggcctagc 34861681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 37686027 - 37686149
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  37686027 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 37686126  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  37686127 atcggagggaaagtaggcctagc 37686149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 37701292 - 37701414
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  37701292 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 37701391  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  37701392 atcggagggaaagtaggcctagc 37701414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 37925616 - 37925494
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||| |  ||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| |||||||    
T  37925616 gaaccttggaggcaacgggtcgggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacattggt 37925517  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  37925516 atcggagggaaagtaggcctagc 37925494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 213 - 466
Target Start/End: Original strand, 39052127 - 39052380
Alignment:
Q  213 gcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacg 312  Q
    ||||| ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||    
T  39052127 gcgttgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacg 39052226  T
Q  313 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 412  Q
    ||   |  || || |||||  |||| ||||| || || || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || ||    
T  39052227 gaggcatttgagctgcattggtaggagcaacggttgctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 39052326  T
Q  413 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     ||||| || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  39052327 attaccatatctcttcgacgcattcacagaggattcagctttctcaaacacaat 39052380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 31876404 - 31876282
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  31876404 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagttccgcgtacaacattggt 31876305  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || |||||||||||||| |||||    
T  31876304 ataggaggaaaagtaggcctagc 31876282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 14 - 156
Target Start/End: Complemental strand, 37375305 - 37375163
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  37375305 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 37375206  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  37375205 agctctgcatacaacataggtataggaggaaaagttggtctag 37375163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 57 - 154
Target Start/End: Original strand, 13936684 - 13936781
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||||||||| |||||||||||    
T  13936684 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtatcggagggaaagtaggtct 13936781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 16829456 - 16829578
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  16829456 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 16829555  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || |||||||||||||| |||||    
T  16829556 ataggaggaaaagtaggcctagc 16829578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 16892025 - 16891903
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  16892025 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 16891926  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || |||||||||||||| |||||    
T  16891925 ataggaggaaaagtaggcctagc 16891903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 32049921 - 32049799
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||| |  ||||| || || |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  32049921 gaaccttggaggcaacgggtccggtgggggtttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 32049822  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  32049821 atcggagggaaagtaggcctagc 32049799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 39890197 - 39890075
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  39890197 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 39890098  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || ||||||||||| ||||||||    
T  39890097 ataggaggaaaagttggtctagc 39890075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Original strand, 12716742 - 12716839
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  12716742 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 12716839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 27777323 - 27777226
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  27777323 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27777226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 27803808 - 27803711
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  27803808 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27803711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 27817081 - 27816984
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  27817081 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27816984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Original strand, 39051962 - 39052059
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  39051962 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 39052059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 14 - 148
Target Start/End: Original strand, 260850 - 260984
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  260850 atcacatttgagatcagacctgaaccttggaggcaacagatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 260949  T
Q  114 aactcggcatatagcattggtatcggaggaaaagt 148  Q
    |  || ||||| | ||||||||| |||||||||||    
T  260950 agttctgcatacaacattggtataggaggaaaagt 260984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 57 - 154
Target Start/End: Original strand, 9350122 - 9350219
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    |||||||||||||| || || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  9350122 ggtggaggcttgccttgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 9350219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 12586911 - 12586814
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || ||  |||| ||||||| ||| ||||| ||||||||||| |||||    
T  12586911 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcgactcagcatataacatcggtataggaggaaaagttggtct 12586814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 119)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 197 - 518
Target Start/End: Original strand, 16626838 - 16627158
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||     
T  16626838 catttgctgaacgatggcattaacgggtaccggaggttgacccgatggtagaggatactgatgatagaacggtggaaagaagggatgctgagagtattgt 16626937  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  16626938 gcatacgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttc-t 16627036  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  16627037 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctaggcg 16627136  T
Q  497 agtccccatgatgtccatctca 518  Q
    |||||||||| || ||||||||    
T  16627137 agtccccatggtgaccatctca 16627158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 197 - 518
Target Start/End: Complemental strand, 18530320 - 18529999
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||| ||| |||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18530320 catttgctgaacgacggcattaacgggcacttgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 18530221  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    |||||||||||||| |||  ||||||||||||||||||||||| ||||||||||||||||||||  | ||||||||||||||||||||||||||||||||    
T  18530220 gcatacgggtacgatggaggtaactgggcagcattaataggggtaacagtagccatggattgactagttccggcagataccatccctacttctgtttctt 18530121  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    ||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  18530120 tcttcttatgatgaccgttaccgtatctctttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacg 18530021  T
Q  497 agtccccatgatgtccatctca 518  Q
    |||||||||| || ||||||||    
T  18530020 agtccccatggtgaccatctca 18529999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 216 - 506
Target Start/End: Original strand, 15893060 - 15893350
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| | ||| |||||||||||||| || |||||||||||||||||||||||  ||||||| ||||||||||||     
T  15893060 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaagggcggaaagaaaggatgctgagagtacggcgcatatgggtacgacggag 15893159  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  15893160 gcatttgggcagcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 15893259  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 506  Q
    ||  |||||||||||||||||  | ||||||||| |||||||||| ||||| || |||||||||| ||||||||| |||||||| ||||||    
T  15893260 actatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacagcttcttccagacgagttcccatg 15893350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 8301618 - 8301919
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| | ||| ||||||||||||||||| |||||||||||||||||||| ||  ||||||| | ||||||||||     
T  8301618 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgagtacgacggag 8301717  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||||||||| ||||| |||||| |||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||| || || || ||    
T  8301718 gcatttgggcagcattgataggagcaacaatagccatggattgaccggctccggcagacaccatccatacttccgtttctttcttcttgtggtgtccatt 8301817  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| ||||||||||| |||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
T  8301818 accatacctctttgacgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 8301917  T
Q  516 tc 517  Q
    ||    
T  8301918 tc 8301919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 8295879 - 8295578
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||| ||||| |||||| |||||| ||  ||||| ||||||||||| ||||| |||||||||||||||||||| ||  ||||||| ||||| ||||||     
T  8295879 ttaacaggtacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 8295780  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || || ||    
T  8295779 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 8295680  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || ||  |||  |||||||| |||||||| |||||| || |||||    
T  8295679 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccttgacggcttcttccagacgagttcccatggtgaccatc 8295580  T
Q  516 tc 517  Q
    ||    
T  8295579 tc 8295578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 18051166 - 18050865
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||||||||| |||||||||||||| ||||| ||  ||||||| ||||| ||||||     
T  18051166 ttaacgggtacttgaggttgacccggtggcagagggtactgatgatagaatggcggaaagaaaggatgttgagaatacggcgcatatgggtatgacggag 18051067  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  18051066 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 18050967  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  18050966 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 18050867  T
Q  516 tc 517  Q
    ||    
T  18050866 tc 18050865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 16626648 - 16626798
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  16626648 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctaagaagtagagt 16626747  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
     |||||||||||| |||||| |||||||||||||||||| |||||||||||    
T  16626748 agggagtaactcgacatatatcattggtatcggaggaaaggtaggtctagc 16626798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 18530504 - 18530354
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18530504 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 18530405  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    | |||||||||| ||||| | |||||||||||||||||| |||||||||||    
T  18530404 caggagtaactcagcatacaacattggtatcggaggaaaggtaggtctagc 18530354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 4797007 - 4797308
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  4797007 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 4797106  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  4797107 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 4797206  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  4797207 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 4797306  T
Q  516 tc 517  Q
    ||    
T  4797307 tc 4797308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 15741436 - 15741737
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  15741436 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 15741535  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  15741536 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 15741635  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
     || |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  15741636 gccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 15741735  T
Q  516 tc 517  Q
    ||    
T  15741736 tc 15741737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 35880670 - 35880369
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  35880670 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 35880571  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  35880570 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 35880471  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  35880470 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 35880371  T
Q  516 tc 517  Q
    ||    
T  35880370 tc 35880369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 4626060 - 4625910
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  4626060 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 4625961  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  4625960 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 4625910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 4721532 - 4721234
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| ||||||||| |||||||||| ||  || |||| ||||| ||||||   |    
T  4721532 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaagatgctgagaatacggcacatatgggtatgacggaggca 4721433  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || |||||    
T  4721432 tttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 4721333  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  4721332 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatctc 4721234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 31034259 - 31034409
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||| ||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  31034259 gatggaaatcacatttgaggtcagaccggaacctaggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 31034358  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  31034359 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 31034409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 32292868 - 32292718
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||| ||| ||||||||| ||||||||||||||||||||||||||||    
T  32292868 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggagacttcccctgtctgattgtgcagtgccctctgagaagtagagt 32292769  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  32292768 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 32292718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 17993926 - 17994076
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  17993926 gatggaaatcacatttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 17994025  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  17994026 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 17994076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 29149109 - 29149410
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    |||||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||||||||||||||| ||  || |||| ||||| ||||||     
T  29149109 ttaacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcacatatgggtatgacggag 29149208  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| |||| |||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  29149209 gcatttgggctgcattgataggagcaatagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 29149308  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  29149309 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 29149408  T
Q  516 tc 517  Q
    ||    
T  29149409 tc 29149410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 5652503 - 5652353
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||| | ||||| ||||||||||||||||||||||||||||||| |||| ||||||||    
T  5652503 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacgggtcaggtgaaggcttgccctgtctggttgtgcagtgccctttgaggagtagagt 5652404  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  5652403 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 5652353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 18330573 - 18330277
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| |||||     ||||||| |||||||||||||||||||||||||| ||  || |||| ||||| ||||||     
T  18330573 ttaacgggtacttgaggttgacccggtggcagagg-----gatgataaaatggtggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 18330479  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  18330478 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 18330379  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||  ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  18330378 accatacctcttcgatgcattcacagaggattcagctttctcgagcacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 18330279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 6192217 - 6191919
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| |||| |||||| ||||| | |||||||||||||||||| ||  || |||| ||||| ||||||   |    
T  6192217 acgggtacttgaggttgacccggtggcagagggtactaatgataaaatggcgaaaagaaaggatgctgagaatacggcacatatgggtatgacggaggca 6192118  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||||||||||||||||||||||||  | || ||||||| |||||| |||||||||||||| || || || |||||    
T  6192117 tttgagctgcattgataggagcaacagtagccatggattgaccggctccaactgacaccatccatacttccgtttctttcttcttgtggtgtccattacc 6192018  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  6192017 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatctc 6191919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 208 - 517
Target Start/End: Complemental strand, 8211653 - 8211344
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  ||||||| |||||    
T  8211653 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcgcatatgggta 8211554  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  8211553 tgacggaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 8211454  T
Q  408 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 507  Q
    || || ||||| |||||||| |||||| | || ||||| ||| ||||||| || ||||| || || || ||||  ||||| || ||||| || ||||||     
T  8211453 tgtccattaccatacctcttcgatgcactcgcagaggactcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 8211354  T
Q  508 tgtccatctc 517  Q
    || |||||||    
T  8211353 tgaccatctc 8211344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Original strand, 17994126 - 17994250
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  17994126 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 17994225  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  17994226 acgacggaggtagctgagcagcatt 17994250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 28116314 - 28116612
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  28116314 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 28116413  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  28116414 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 28116513  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| |||||| | |  || |||||| ||||||| || |||||||| || || ||||  ||||| || ||||| || |||||| || |||||||    
T  28116514 atacctcttcgatgcactcgtagaagattcagctttctcaaacacaataattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 28116612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 216 - 331
Target Start/End: Complemental strand, 4625851 - 4625736
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    |||||||||||||||||| |||||||||| | ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||     
T  4625851 ttaacgggtacctgaggttgacccgatggcaaaggatactgatgatataatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggag 4625752  T
Q  316 ataactgggcagcatt 331  Q
     || ||| ||||||||    
T  4625751 gtagctgagcagcatt 4625736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 7073113 - 7072815
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  7073113 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 7073014  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||||||||||||||||| |||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  7073013 tttgagctgcattgataggagcaacagtagccatggattgactggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 7072914  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| || |||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  7072913 atacctcttcgacgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 7072815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 208 - 517
Target Start/End: Original strand, 18277398 - 18277707
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| |||||    
T  18277398 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 18277497  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  18277498 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 18277597  T
Q  408 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 507  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
T  18277598 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 18277697  T
Q  508 tgtccatctc 517  Q
    || |||||||    
T  18277698 tgaccatctc 18277707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 208 - 517
Target Start/End: Original strand, 18292699 - 18293008
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| |||||    
T  18292699 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 18292798  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  18292799 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 18292898  T
Q  408 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 507  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
T  18292899 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 18292998  T
Q  508 tgtccatctc 517  Q
    || |||||||    
T  18292999 tgaccatctc 18293008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 208 - 517
Target Start/End: Original strand, 18308000 - 18308309
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| |||||    
T  18308000 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 18308099  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  18308100 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 18308199  T
Q  408 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 507  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
T  18308200 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 18308299  T
Q  508 tgtccatctc 517  Q
    || |||||||    
T  18308300 tgaccatctc 18308309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 207 - 331
Target Start/End: Complemental strand, 5652303 - 5652179
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||| | | | |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  5652303 acgacggcattaacgggtacctgaggttgacccgattgcaaacgatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 5652204  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  5652203 acgacggaggtagctgagcagcatt 5652179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 208 - 427
Target Start/End: Complemental strand, 20065958 - 20065739
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| |||||    
T  20065958 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggta 20065859  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  ||||| ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| || ||||||||||| |||    
T  20065858 tgacggaggcatttgggctgcattgataggagcaacagtggccatggattgaccggctccagctgacaccatccccacttccgtatctttcttcttgtga 20065759  T
Q  408 tgaccgttaccgtacctctt 427  Q
    || || ||||| ||||||||    
T  20065758 tgtccattaccatacctctt 20065739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 208 - 506
Target Start/End: Complemental strand, 10396048 - 10395750
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| ||||| ||||||||||||||||| || ||  ||  ||| |||||    
T  10396048 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaatggcggaaagaaaggatgctgggaatacggcatatatgggta 10395949  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  10395948 tgacggaggcatttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 10395849  T
Q  408 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 506  Q
    || || ||||| || ||||| ||||||||  | ||||||||| ||||||| || |||||||| || || ||||  ||||| || ||||| || ||||||    
T  10395848 tgtccattaccatatctcttcgatgcattcacagaggattcagctttctcaaacacaataattccatccctgacggcttcctcaagacgggttcccatg 10395750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 47023354 - 47023056
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| ||||||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||||| ||  ||   || ||||| ||||||   |    
T  47023354 acgggcacctgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 47023255  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  47023254 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 47023155  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| ||||||||  | ||||||||  ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  47023154 atacctcttcgatgcattcacagaggattcggctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 47023056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 252 - 466
Target Start/End: Original strand, 22871264 - 22871478
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   | ||| || ||||| ||||| |||||||||||||    
T  22871264 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatctgagctgcattgataggtgcaacagtagcca 22871363  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | || ||||||||| |    
T  22871364 tagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgcagaggattcagc 22871463  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  22871464 tttctcaaacacaat 22871478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 252 - 466
Target Start/End: Original strand, 22886323 - 22886537
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   | ||| || ||||| ||||| |||||||||||||    
T  22886323 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatctgagctgcattgataggtgcaacagtagcca 22886422  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | || ||||||||| |    
T  22886423 tagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgcagaggattcagc 22886522  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  22886523 tttctcaaacacaat 22886537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 252 - 433
Target Start/End: Complemental strand, 5466853 - 5466672
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| |||||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  5466853 tactgatgataaaatggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 5466754  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 433  Q
    | ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| ||||||||||||||    
T  5466753 tagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctctttgatgc 5466672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 252 - 457
Target Start/End: Original strand, 5596756 - 5596961
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||||||||||   |  || || ||||| ||||| ||||| |||||||    
T  5596756 tactgatgataaaacggtgggaagaatggatgctgagaatacggcatatatgggtacgacggaggcatttgagctgcattgataggagcaacggtagcca 5596855  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | || |||||||||||    
T  5596856 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgcagaggattcaac 5596955  T
Q  452 tttctc 457  Q
    ||||||    
T  5596956 tttctc 5596961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 219 - 331
Target Start/End: Complemental strand, 5713128 - 5713016
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||  ||    
T  5713128 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5713029  T
Q  319 actgggcagcatt 331  Q
     ||| ||||||||    
T  5713028 gctgagcagcatt 5713016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 219 - 331
Target Start/End: Complemental strand, 5724038 - 5723926
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||  ||    
T  5724038 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5723939  T
Q  319 actgggcagcatt 331  Q
     ||| ||||||||    
T  5723938 gctgagcagcatt 5723926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 219 - 331
Target Start/End: Original strand, 5757439 - 5757551
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||  ||    
T  5757439 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5757538  T
Q  319 actgggcagcatt 331  Q
     ||| ||||||||    
T  5757539 gctgagcagcatt 5757551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 219 - 331
Target Start/End: Original strand, 5768330 - 5768442
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||  ||    
T  5768330 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5768429  T
Q  319 actgggcagcatt 331  Q
     ||| ||||||||    
T  5768430 gctgagcagcatt 5768442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 219 - 469
Target Start/End: Complemental strand, 7996463 - 7996213
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| | ||||   |    
T  7996463 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 7996364  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  7996363 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 7996264  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataat 469  Q
     |||||||| || ||| | || || |||||| ||||||| || ||||||||    
T  7996263 atacctcttcgaggcactcgcagaagattcagctttctcaaacacaataat 7996213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 219 - 469
Target Start/End: Complemental strand, 10642971 - 10642721
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| | ||||   |    
T  10642971 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 10642872  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  10642871 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 10642772  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataat 469  Q
     |||||||| || ||| | || || |||||| ||||||| || ||||||||    
T  10642771 atacctcttcgaggcactcgcagaagattcagctttctcaaacacaataat 10642721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 15892876 - 15892998
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    ||||||||||||||| |||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | |||||||    
T  15892876 gaacctgggaggcaaaggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacattggt 15892975  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  15892976 atcggagggaaagtaggtctagc 15892998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 18225059 - 18224877
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  18225059 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 18224960  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
T  18224959 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 18224877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 228 - 517
Target Start/End: Complemental strand, 21674585 - 21674296
Alignment:
Q  228 tgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcag 327  Q
    |||||| |||||| ||| || || |||||||| || ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||   |  || || |    
T  21674585 tgaggttgacccggtggcagggggtactgatggtaaaatggcggaaagaacggatgctgagaatacggcacatatgggtatgacggaggcatttgagctg 21674486  T
Q  328 cattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctt 427  Q
    |||| ||||| || || |||||||||| |||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || |||||    
T  21674485 cattgataggagccacggtagccatgggttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctctt 21674386  T
Q  428 tgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     ||||||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  21674385 cgatgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 21674296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 8296060 - 8295938
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||||||||||||| ||| |||| | |||||||||||||||||||| || ||||||||| | |||| |||||| || ||||| ||||| | ||| |||    
T  8296060 gaacctgggaggcaacagatcaggtaggggcttgccctgtctggttgtacaatgccctctgtggagtaaagtcggaagcaactcagcatacaacatcggt 8295961  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  8295960 atcggagggaaagtaggtctagc 8295938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 8301437 - 8301559
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  8301437 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 8301536  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  8301537 atcggagggaaagtaggtctagc 8301559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 17985346 - 17985528
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
T  17985346 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 17985445  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| |||||||||    
T  17985446 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctttttgatgca 17985528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 18330757 - 18330635
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | ||||  ||||| || ||||| ||||||| ||| |||    
T  18330757 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaggtcggaagcaactcagcatataacatcggt 18330658  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  18330657 atcggagggaaagtaggtctagc 18330635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 28021146 - 28020964
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| | ||| ||||| |||||||||||||    
T  28021146 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgtattgataggagcaacagtagcca 28021047  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    ||||||| |||||||| || || |||||||| ||||| ||||| |||||||| || || |||||||| |||||||||||||||    
T  28021046 tggattgcccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtccgttaccatacctctttgatgca 28020964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 219 - 457
Target Start/End: Original strand, 36997446 - 36997684
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| ||||||||| | || | ||| ||||| ||||||||||| || ||||| ||||||||||||||||| ||  ||   || ||||| ||||||   |    
T  36997446 acgggcacctgaggttggccgggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 36997545  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  36997546 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 36997645  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctc 457  Q
     || ||||| || |||||| | ||||||||| |||||||    
T  36997646 atatctcttcgacgcatttacagaggattcagctttctc 36997684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 252 - 517
Target Start/End: Complemental strand, 5013580 - 5013315
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| || || |||||||||||||    
T  5013580 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 5013481  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |  || |||||| |    
T  5013480 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcgtagaagattcagc 5013381  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  5013380 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5013315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 252 - 505
Target Start/End: Original strand, 6542864 - 6543117
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  6542864 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 6542963  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | |  || |||||| |    
T  6542964 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgtagaagattcagc 6543063  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 505  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||    
T  6543064 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccat 6543117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 4721740 - 4721597
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| |||||||| ||   |||||| ||||||| ||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  4721740 atcacatttgaggtcggacctgaaccttggaggcagcggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 4721641  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  4721640 aactcagcatataacatcggtatcggagggaaagtaggtctagc 4721597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 219 - 466
Target Start/End: Original strand, 11110718 - 11110965
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||||| ||  ||   || ||||| ||||||   |    
T  11110718 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 11110817  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || |  ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| ||||| |||||||| || || || |||||    
T  11110818 tttgagttgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtccattacc 11110917  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  11110918 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 11110965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 22387727 - 22387870
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  22387727 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 22387826  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||| | ||||||||| ||||||||||| ||||||||    
T  22387827 aactctgcatacaacattggtataggaggaaaagtcggtctagc 22387870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 4347074 - 4347256
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  | | ||||| ||||||   |  ||||| || || ||||| |||||||||||||    
T  4347074 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatacatgggtatgacggaggcatttgggctgcgttgataggagcaacagtagcca 4347173  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  4347174 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 4347256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 4796823 - 4796945
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  4796823 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 4796922  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  4796923 atcggagggaaagtaggtctagc 4796945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 15741264 - 15741386
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| |||||||||| || |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  15741264 gaaccttggaggcaacgaatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 15741363  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  15741364 atcggagggaaagtaggtctagc 15741386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 17985126 - 17985248
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  17985126 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 17985225  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || ||||||||||||||||||||    
T  17985226 ataggaggaaaagtaggtctagc 17985248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 18051350 - 18051228
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||||||||||| ||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  18051350 gaacctgggaggcagcggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatacaacatcggt 18051251  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  18051250 atcggagggaaagtaggtctagc 18051228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 466
Target Start/End: Complemental strand, 18242595 - 18242381
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
T  18242595 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 18242496  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  18242495 ttgattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 18242396  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  18242395 tttctcaaacacaat 18242381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 35 - 156
Target Start/End: Original strand, 6542632 - 6542753
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  6542632 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 6542731  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  6542732 ataggaggaaaagttggtctag 6542753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 5609471 - 5609614
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  5609471 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 5609570  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  5609571 aactcagcatataacatcggtatcggagggaaagtaggcctagc 5609614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 6192425 - 6192282
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| |||||||| ||   |||||| ||||||| | ||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  6192425 atcacatttgaggtcggacctgaaccttggaggcagcagatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 6192326  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  6192325 aactcagcatataacatcggtatcggagggaaagtaggtctagc 6192282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 18277201 - 18277344
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18277201 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18277300  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  18277301 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18277344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 18292502 - 18292645
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18292502 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18292601  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  18292602 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18292645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 18307803 - 18307946
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18307803 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18307902  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  18307903 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18307946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 327 - 466
Target Start/End: Original strand, 20577327 - 20577466
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  20577327 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 20577426  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  20577427 tcgacgcattcacagaggattcagctttctcaaacacaat 20577466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 28339411 - 28339268
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28339411 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 28339312  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  28339311 aactcagcatataacatcggtatcggagggaaagtaggcctagc 28339268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 29148904 - 29149047
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  29148904 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagc 29149003  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  29149004 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 29149047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 31964622 - 31964765
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  31964622 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 31964721  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  31964722 aactcagcatataacatcggtatcggagggaaagtaggcctagc 31964765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 50134220 - 50134363
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  50134220 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 50134319  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  50134320 aactcagcatataacatcggtatcggagggaaagtaggcctagc 50134363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 35880854 - 35880732
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||| ||||| |||||| |||||||||||| ||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  35880854 gaaccttggaggcagcggatcaggtgggggcttgccctgtttggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 35880755  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  35880754 atcggagggaaagtaggtctagc 35880732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 327 - 457
Target Start/End: Complemental strand, 51781804 - 51781674
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  51781804 gcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 51781705  T
Q  427 ttgatgcatttgcggaggattcaactttctc 457  Q
    | || |||||| | ||||||||| |||||||    
T  51781704 tcgacgcatttacagaggattcagctttctc 51781674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 457
Target Start/End: Complemental strand, 24328027 - 24327822
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  24328027 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 24327928  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  24327927 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 24327828  T
Q  452 tttctc 457  Q
    ||||||    
T  24327827 tttctc 24327822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 433
Target Start/End: Complemental strand, 28339170 - 28338989
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| || || |||||||    
T  28339170 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcgacggtagcca 28339071  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 433  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
T  28339070 tggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 28338989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 433
Target Start/End: Original strand, 31964863 - 31965044
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| || || |||||||    
T  31964863 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcgacggtagcca 31964962  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 433  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
T  31964963 tggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 31965044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 433
Target Start/End: Original strand, 50134461 - 50134642
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| || || |||||||    
T  50134461 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcgacggtagcca 50134560  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 433  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
T  50134561 tggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 50134642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 219 - 403
Target Start/End: Original strand, 29665342 - 29665526
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  ||   || ||||| ||||||   |    
T  29665342 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatgtatgggtatgacggaggca 29665441  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttctt 403  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| ||||||||||||||    
T  29665442 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttctt 29665526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 4417028 - 4416885
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| || ||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  4417028 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggtttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 4416929  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  4416928 aactcagcatataacatcggtatcggagggaaagtaggcctagc 4416885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 5713315 - 5713196
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5713315 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5713216  T
Q  135 atcggaggaaaagtaggtct 154  Q
    |||||||| |||||||||||    
T  5713215 atcggagggaaagtaggtct 5713196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 5724225 - 5724106
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5724225 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5724126  T
Q  135 atcggaggaaaagtaggtct 154  Q
    |||||||| |||||||||||    
T  5724125 atcggagggaaagtaggtct 5724106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 5757252 - 5757371
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5757252 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5757351  T
Q  135 atcggaggaaaagtaggtct 154  Q
    |||||||| |||||||||||    
T  5757352 atcggagggaaagtaggtct 5757371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 5768143 - 5768262
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5768143 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5768242  T
Q  135 atcggaggaaaagtaggtct 154  Q
    |||||||| |||||||||||    
T  5768243 atcggagggaaagtaggtct 5768262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 10396242 - 10396099
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||||||||| |||||  | |||| ||| || ||     
T  10396242 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtgcagtgtcctctctggagtaaagttggaaga 10396143  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    | ||| ||||| | ||| ||||||||||| ||||||||||||||    
T  10396142 agctctgcatacaacataggtatcggagggaaagtaggtctagc 10396099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 28116103 - 28116246
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| | |||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28116103 atcacatttgagatcagacctgaaccttggaggcaacggatcaagtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 28116202  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
T  28116203 aattcagcatataacatcggtatcggagggaaagtaggtctagc 28116246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 36997247 - 36997366
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  36997247 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 36997346  T
Q  135 atcggaggaaaagtaggtct 154  Q
    || ||||||||||| |||||    
T  36997347 ataggaggaaaagttggtct 36997366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 327 - 433
Target Start/End: Complemental strand, 4416709 - 4416603
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  4416709 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 4416610  T
Q  427 ttgatgc 433  Q
    | |||||    
T  4416609 tcgatgc 4416603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 7996650 - 7996528
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  7996650 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 7996551  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  7996550 atcggagggaaagtaggcctagc 7996528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 10643158 - 10643036
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  10643158 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 10643059  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  10643058 atcggagggaaagtaggcctagc 10643036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 47023541 - 47023419
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  47023541 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 47023442  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  47023441 atcggagggaaagtaggcctagc 47023419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 208 - 356
Target Start/End: Original strand, 22387921 - 22388069
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || | ||| ||||| ||||||||||||||| | ||||| |||||    
T  22387921 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacgatgggaagaacggatgctgagagtatggtgcataagggta 22388020  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 356  Q
     |||||    ||||| |||||||| ||||| ||||||||||||||||||    
T  22388021 ggacgggggaaactgagcagcattgataggagcaacagtagccatggat 22388069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 327 - 430
Target Start/End: Original strand, 5609787 - 5609890
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  5609787 gcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 5609886  T
Q  427 ttga 430  Q
    ||||    
T  5609887 ttga 5609890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 7073321 - 7073178
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||| || ||||| || ||||| || || || ||||||||  | |||| ||| || ||     
T  7073321 atcacatttgagatcagacctgaaccttggaggcaacggatcaggcgggggcttaccttgtctagtcgtacaatgccctctttggagtaaagttggaagc 7073222  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||||||||||||||||||    
T  7073221 aactcagcatataacatcggtatcggaggaaaagtaggtctagc 7073178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 21674802 - 21674659
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || ||     
T  21674802 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctttggagtagagttggaaga 21674703  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  21674702 agttctgcatacaacattggtataggaggaaaagttggtctagc 21674659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 219 - 466
Target Start/End: Complemental strand, 48465816 - 48465569
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| |||  | || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
T  48465816 acgggcacttgaggttgacccggtggcggggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 48465717  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
T  48465716 tttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 48465617  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  48465616 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 48465569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 327 - 457
Target Start/End: Complemental strand, 51796893 - 51796762
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatg-accgttaccgtacctc 425  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || ||  || ||||| || |||    
T  51796893 gcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtgccattaccatatctc 51796794  T
Q  426 tttgatgcatttgcggaggattcaactttctc 457  Q
    || || |||||| | ||||||||| |||||||    
T  51796793 ttcgacgcatttacagaggattcagctttctc 51796762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 208 - 506
Target Start/End: Complemental strand, 32439069 - 32438771
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
T  32439069 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 32438970  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     |||||    ||||| |||||||| | ||| |||||||||||| ||||| ||   | ||| || | || ||| || || || || ||||||||||| |||    
T  32438969 ggacgggggaaactgagcagcattgacaggagcaacagtagccttggatggattagttccagcggctatcattcccacctccgtatctttcttcttgtga 32438870  T
Q  408 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 506  Q
    || || |||||||| ||||| |  |||||||| || || ||||  ||||| || ||||| |||||||| |  | ||||||||| ||||| || ||||||    
T  32438869 tgtccattaccgtatctcttcgcagcatttgcagatgactcaatcttctcaaacacaatgatgccttcccgaacagcttcttccagacgtgttcccatg 32438771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 208 - 356
Target Start/End: Complemental strand, 4893125 - 4892977
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
T  4893125 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 4893026  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 356  Q
     |||||    ||||| |||||||| ||||| |||||||||||| |||||    
T  4893025 ggacgggggaaactgagcagcattgataggagcaacagtagccttggat 4892977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 14 - 154
Target Start/End: Original strand, 11110498 - 11110638
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||||||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  11110498 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 11110597  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
T  11110598 agttctgcatacaacattggtataggaggaaaagttggtct 11110638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 4346836 - 4346979
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  4346836 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 4346935  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  4346936 agttctgcatacaacattggtataggaggaaaagttggtctagc 4346979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 35 - 156
Target Start/End: Complemental strand, 18242827 - 18242706
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  18242827 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 18242728  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  18242727 ataggaggaaaagttggtctag 18242706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 35 - 155
Target Start/End: Complemental strand, 5467073 - 5466953
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | ||| |||    
T  5467073 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaaggagttctgcatacaacataggt 5466974  T
Q  135 atcggaggaaaagtaggtcta 155  Q
    ||  |||||||||| ||||||    
T  5466973 ataagaggaaaagttggtcta 5466953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 14 - 154
Target Start/End: Complemental strand, 48466036 - 48465896
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  48466036 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctttggagtaaagttggaaga 48465937  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
T  48465936 agttctgcatacaacattggtataggaggaaaagttggtct 48465896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 22871005 - 22871148
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  22871005 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 22871104  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  22871105 agttctgcatacaacattggtataggaggaaaagttggtctagc 22871148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 22886064 - 22886207
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  22886064 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 22886163  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  22886164 agttctgcatacaacattggtataggaggaaaagttggtctagc 22886207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 28021384 - 28021241
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||| || |||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28021384 atcacatttgagatcagacctgaaccttggaggtaatggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtatagttggaaga 28021285  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  28021284 agttctgcatacaacattggtataggaggaaaagttggtctagc 28021241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 35 - 94
Target Start/End: Complemental strand, 51782111 - 51782052
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 94  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
T  51782111 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 51782052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 4893318 - 4893176
Alignment:
Q  15 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 114  Q
    |||||||| || ||||| |||||||| ||||| || || |  |||||||| |||||||| || || |||||||| |||||  | |||| ||| || || |    
T  4893318 tcacacttaagatcagagtggaaccttggaggtaaagggtccggtggaggtttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 4893219  T
Q  115 actcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  4893218 gctctgcatacaacattggtataggaggaaaagttggtctagc 4893176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 35 - 148
Target Start/End: Complemental strand, 5013800 - 5013687
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  5013800 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagttccgcgtacaacattggt 5013701  T
Q  135 atcggaggaaaagt 148  Q
    || |||||||||||    
T  5013700 ataggaggaaaagt 5013687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 35 - 156
Target Start/End: Original strand, 5596527 - 5596648
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  5596527 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 5596626  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||| || || |||||||    
T  5596627 ataggagggaaggttggtctag 5596648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Original strand, 20577039 - 20577136
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  20577039 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 20577136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Original strand, 29665162 - 29665259
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  29665162 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 29665259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 57 - 156
Target Start/End: Complemental strand, 20066109 - 20066010
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || | ||| ||||| | ||||||||| ||||||||||| |||||||    
T  20066109 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaagctctgcatacaacattggtataggaggaaaagttggtctag 20066010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 51797192 - 51797141
Alignment:
Q  43 gaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 94  Q
    |||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
T  51797192 gaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 51797141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 14 - 148
Target Start/End: Complemental strand, 8211847 - 8211713
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  8211847 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 8211748  T
Q  114 aactcggcatatagcattggtatcggaggaaaagt 148  Q
    |  || ||||| | ||||||||| |||||||||||    
T  8211747 agttctgcatacaacattggtataggaggaaaagt 8211713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 18225279 - 18225157
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  18225279 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 18225180  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || ||||| || ||||| |||||    
T  18225179 ataggagggaaggtaggcctagc 18225157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 32439262 - 32439120
Alignment:
Q  15 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 114  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  32439262 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 32439163  T
Q  115 actcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
      || ||||| | ||||||||| ||||||||||| ||||||||    
T  32439162 gttctgcatacaacattggtataggaggaaaagttggtctagc 32439120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 197 - 518
Target Start/End: Complemental strand, 20461069 - 20460748
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  20461069 catttgctgaacgatggcattaacgggtacctgaggttgacccgatggtagaggatattgatgatagaatggtggaaagaaaggatgctgagagtattgc 20460970  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  20460969 gcatacgggtacggcggaggtaactgggcagcattaataggggcaatagtagccatggattgaccggctccggcagataccatccctacttctatttctt 20460870  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||    
T  20460869 tcttcttatgatgaccgttaccgtacctctttgatgcattggcggaggattcaactttctcgaatataataatgccttctctgacagcttcttctaggcg 20460770  T
Q  497 agtccccatgatgtccatctca 518  Q
    |||||||||| || ||||||||    
T  20460769 agtccccatggtgaccatctca 20460748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 197 - 518
Target Start/End: Original strand, 16208319 - 16208640
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||||||| |||| ||||||||||||  ||||||||||| | |||||||| |||||||||||||| ||||||||||||||||||||||||    
T  16208319 catttgctgaacgatggcattaatgggtacctgaggctgacccgatggtggtggatactggtgatagaatggtgggaagaaaggatgctgagagtattgc 16208418  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
       ||| | |||| ||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  16208419 atgtactgatacggcggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatctctacttctgtttctt 16208518  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    ||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||| |||||||||||||||    
T  16208519 tcttcttatgatgaccgttaccgtaactctttgatgcatttacagaggattcaactttctcaaatacaataatgccttctctgacagcttcttctagacg 16208618  T
Q  497 agtccccatgatgtccatctca 518  Q
    |||||||||| || ||||||||    
T  16208619 agtccccatggtgaccatctca 16208640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 20461228 - 20461085
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20461228 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 20461129  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||||||||| ||||||||||||| |||||||||||    
T  20461128 aactcggcatatagcattagtatcggaggaaaggtaggtctagc 20461085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 16208132 - 16208282
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||    
T  16208132 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggttttccctgtctggttgtgcagtgccctctgagaagtagagt 16208231  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||||| ||| | |||||||||||||||||| |||||||||||    
T  16208232 cgggagtaactcggtatacaacattggtatcggaggaaaggtaggtctagc 16208282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 20340436 - 20340586
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  20340436 gatggaaatcacacttgaggtcagaacggaacctaggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 20340535  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
     ||||||| |||||||||||||||||||||||||||||| |||||||||||    
T  20340536 tgggagtagctcggcatatagcattggtatcggaggaaaggtaggtctagc 20340586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 28152016 - 28151866
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||| ||||||||| ||| ||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  28152016 gatggaaatcacatttgaggtcagaccggagcctgggaggtaacagatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 28151917  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  28151916 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 28151866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 197 - 331
Target Start/End: Original strand, 20340626 - 20340760
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||| | ||||| ||| || ||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||    
T  20340626 catttgttgaacgacggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 20340725  T
Q  297 gcatacgggtacgacggaaataactgggcagcatt 331  Q
    || |||||||||||||||  || ||| ||||||||    
T  20340726 gcgtacgggtacgacggaggtagctgagcagcatt 20340760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 41793624 - 41793922
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||| ||||| ||  ||  ||| ||||| ||||||   |    
T  41793624 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgttgagaatacggcatatatgggtatgacggaggca 41793723  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      ||||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| || ||||| |||||||||||||| || || || |||||    
T  41793724 tttgggctgcattgataggagcaacggtagccatggattgaccggctccagctgataccattcccacttccgtttctttcttcttgtggtgtccattacc 41793823  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     ||||||||||||||| |  | |||| |||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  41793824 atacctctttgatgcactcacagaggtttcagctttctcaaacacaatgatcccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 41793922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 252 - 466
Target Start/End: Complemental strand, 10962576 - 10962362
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  10962576 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 10962477  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |    
T  10962476 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagc 10962377  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  10962376 tttctcaaacacaat 10962362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 252 - 466
Target Start/End: Complemental strand, 51638124 - 51637910
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  51638124 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 51638025  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| || ||| |||| || |||||| |    
T  51638024 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgacgcacttgcagaagattcagc 51637925  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  51637924 tttctcaaacacaat 51637910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 41793416 - 41793559
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  41793416 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 41793515  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  41793516 aactcagcatataacatcggtatcggagggaaagtaggcctagc 41793559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 252 - 457
Target Start/End: Complemental strand, 28584887 - 28584682
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||||||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  28584887 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatacgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 28584788  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  28584787 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 28584688  T
Q  452 tttctc 457  Q
    ||||||    
T  28584687 tttctc 28584682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 28585107 - 28584985
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28585107 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 28585008  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  28585007 atcggagggaaagtaggcctagc 28584985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 10962796 - 10962674
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | || | ||| || || ||||| ||||||| ||| |||    
T  10962796 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagcaaagttggaagcaactcagcatataacatcggt 10962697  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  10962696 atcggagggaaagtaggcctagc 10962674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 50)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 197 - 516
Target Start/End: Original strand, 15285219 - 15285538
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15285219 catttgctgaacgatggcattaacgggcacctgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 15285318  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||| |||||| | |||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||    
T  15285319 gcatatgggtacaatggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatccatacttctgtttctt 15285418  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||    
T  15285419 tcttcttatgatgaccgttaccgttcctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgacagcttcttctaggcg 15285518  T
Q  497 agtccccatgatgtccatct 516  Q
    |||||||||| || ||||||    
T  15285519 agtccccatggtgaccatct 15285538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 250; E-Value: 1e-138
Query Start/End: Original strand, 197 - 518
Target Start/End: Complemental strand, 15227850 - 15227529
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| |||||  || |||||||||||||||||| |||||||||| | |||||| ||||||||||||||||||||||| ||||||||||||||||||    
T  15227850 catttgctgaacgacagcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgc 15227751  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  15227750 gcatacgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatccctacttctgtttctt 15227651  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||    
T  15227650 tcttcttatgatgaccgttaccatgcctctttgatgcatttgcggaggattcatctttctcgaatacaataatgccttctctgacagcttcttctagacg 15227551  T
Q  497 agtccccatgatgtccatctca 518  Q
    |||||||||| || ||||||||    
T  15227550 agtccccatggtgaccatctca 15227529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 197 - 518
Target Start/End: Complemental strand, 1900237 - 1899916
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||| ||    
T  1900237 catttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 1900138  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1900137 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 1900038  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||| ||||||||| | |||    
T  1900037 tcttcttatgatgatcgttaccgtacctctttgatgcatttacagaggattcaactttctcaaatacaataatgccttctctgacagcttcttccaaacg 1899938  T
Q  497 agtccccatgatgtccatctca 518  Q
    |||||||||| || ||||||||    
T  1899937 agtccccatggtgaccatctca 1899916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 197 - 518
Target Start/End: Original strand, 14235819 - 14236140
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| | | ||||| |||||||||||||  ||  |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||    
T  14235819 catttgctgagcaatggcattaacgggtacctatgggtgacccgatggtagagggtactgatgatagaatggtgggaagaaaggatgctgagagtattgc 14235918  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
      |||| |||||| | ||  |||||| |||||||||||||||| |||||| ||||||||||||| || ||||||||||||||||||||||||||| ||||    
T  14235919 atatactggtacggcagaggtaactgagcagcattaataggggtaacagtggccatggattgactggttccggcagataccatccctacttctgtctctt 14236018  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||||| ||||||||| |||||||||   |||| ||||||||  |||||||||| ||||||||| ||||||||| ||| |||||||  ||    
T  14236019 tcttcttatgatgaccattaccgtacttctttgatgtgcttgcagaggattcccctttctcgaacacaataatgtcttctctgacagcctcttctaagcg 14236118  T
Q  497 agtccccatgatgtccatctca 518  Q
     || |||||| || ||||||||    
T  14236119 ggttcccatggtgaccatctca 14236140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 14664976 - 14664675
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  | ||||| ||||| ||||||     
T  14664976 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggtgcatatgggtatgacggag 14664877  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || || || ||    
T  14664876 gcatttgggcagcattgataggagcaacagtagccatggattgaccagctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 14664777  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| || |  ||||| || |||||||| |||||| || |||||    
T  14664776 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctaacggcttcctccagacgagttcccatggtgaccatc 14664677  T
Q  516 tc 517  Q
    ||    
T  14664676 tc 14664675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 15228040 - 15227890
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| |||||||||||||||| |||| |||||||||||| |||||||||||||| |||||||||||||||||||||||    
T  15228040 gatggaaatcacacttgaggtcagaacggaacctgggaggcaatggatcaggtggaggcttaccctgtctggttgtacagtgccctctgagaagtagagt 15227941  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  15227940 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 15227890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 15285029 - 15285179
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||  ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15285029 gatggaaatcacacttgaggtcagaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 15285128  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||||  |||||||||||||||||||||||| |||||||||||    
T  15285129 cgggagtaactcgaaatatagcattggtatcggaggaaaggtaggtctagc 15285179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 17013958 - 17013657
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  ||||||| ||||| || |||     
T  17013958 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgaaggag 17013859  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||| || || || ||    
T  17013858 gcatttgggctgcattgataggagcaacagtagccatggattgaccagctccggctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 17013759  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  17013758 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 17013659  T
Q  516 tc 517  Q
    ||    
T  17013658 tc 17013657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 1900427 - 1900277
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| | |||||| || ||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||    
T  1900427 gatggaaatcacacttgaggtcagaacgaaacctgagaagcaacggatcaggtggaggcttaccatgtctggttgtgcagtgccctctgagaagtagagt 1900328  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||||||||| |||||||||||||||||||| |||||||||||    
T  1900327 cgggagtaactcggcatacagcattggtatcggaggaaaggtaggtctagc 1900277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 221 - 518
Target Start/End: Original strand, 15391650 - 15391948
Alignment:
Q  221 gggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataac 320  Q
    ||||||||||||| ||||||  | | | |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||| | |||| ||||  || |    
T  15391650 gggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatacggcggaggtagc 15391749  T
Q  321 tgggcagcattaataggggcaa-cagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccg 419  Q
    || ||| |||| || ||||||| |||||||||||||||||| || ||| ||||||||||||||||||||||| |||||||||||||||||||| || ||     
T  15391750 tgagcaacattgatgggggcaaacagtagccatggattgactggttccagcagataccatccctacttctgtctctttcttcttatgatgaccattgcca 15391849  T
Q  420 tacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctca 518  Q
    ||| || ||||||||||||| ||||||||| ||||| | || ||||||||||| ||||||| ||| |||||||  || || |||||| || ||||||||    
T  15391850 tacttccttgatgcatttgcagaggattcacctttcccaaacacaataatgccatctctgacagcctcttctaagcgggttcccatggtgaccatctca 15391948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 24592624 - 24592925
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  24592624 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 24592723  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  24592724 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 24592823  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| ||||| || |||||| || |||||    
T  24592824 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgggttcccatggtgaccatc 24592923  T
Q  516 tc 517  Q
    ||    
T  24592924 tc 24592925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 24460706 - 24460856
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  24460706 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 24460805  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  24460806 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 24460856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 7 - 154
Target Start/End: Original strand, 15391439 - 15391586
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||| | |||    
T  15391439 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacgggttaggtggaggcttcccctgcctggttgtgcagtgccctttgagaagcaaagt 15391538  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    |||||| |||||||| || |||||||||||||||||||| ||||||||    
T  15391539 cgggagcaactcggcgtacagcattggtatcggaggaaaggtaggtct 15391586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 14235626 - 14235776
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| ||||||||  ||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| | ||||| |||||    
T  14235626 gatggaaatcacatttgaggtcgaaatggaacctgggaggcaaagggttaggtggaggcttgccctgtctggttgtacagtgccctttaagaagcagagt 14235725  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| | ||||||||| | |||||||||| ||||||| |||||||||||    
T  14235726 cgggagcagctcggcatacaacattggtatcagaggaaaggtaggtctagc 14235776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 6569811 - 6569510
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||||| ||  ||  ||| ||||| ||||||     
T  6569811 ttaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggag 6569712  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||    
T  6569711 gcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccatt 6569612  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| || ||||| |||||||| || ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  6569611 accatatctcttcgatgcattcgcagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatc 6569512  T
Q  516 tc 517  Q
    ||    
T  6569511 tc 6569510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 207 - 331
Target Start/End: Original strand, 24460906 - 24461030
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | || ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  24460906 acgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 24461005  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  24461006 acgacggaggtagctgagcagcatt 24461030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 208 - 517
Target Start/End: Original strand, 14763609 - 14763918
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| |||||    
T  14763609 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 14763708  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  14763709 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 14763808  T
Q  408 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 507  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
T  14763809 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 14763908  T
Q  508 tgtccatctc 517  Q
    || |||||||    
T  14763909 tgaccatctc 14763918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 208 - 517
Target Start/End: Original strand, 36344817 - 36345126
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||||||||||||||| || ||| | ||||| ||||||||||||||  || |||| |||||    
T  36344817 cgatggcattgacaggaacctgaggttggcccggtggcaaaggatactgatgataaaacggtaggaagaacggatgctgagagtacggcacatatgggta 36344916  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  36344917 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 36345016  T
Q  408 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 507  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
T  36345017 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 36345116  T
Q  508 tgtccatctc 517  Q
    || |||||||    
T  36345117 tgaccatctc 36345126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 235 - 517
Target Start/End: Complemental strand, 19373200 - 19372918
Alignment:
Q  235 gacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaat 334  Q
    |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| ||||||   |  || || ||||| ||    
T  19373200 gacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgagctgcattgat 19373101  T
Q  335 aggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    ||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  19373100 aggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 19373001  T
Q  435 tttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    ||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  19373000 ttcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 19372918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 27163633 - 27163931
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  27163633 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 27163732  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  27163733 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattacc 27163832  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || |||||| | |  || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  27163833 gtaccttttcgatgcactcgtagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 27163931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 225 - 466
Target Start/End: Complemental strand, 54833339 - 54833098
Alignment:
Q  225 acctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactggg 324  Q
    ||||||||| | |||| ||||| ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| ||||||   |  || |    
T  54833339 acctgaggttggcccggtggtaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgag 54833240  T
Q  325 cagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacct 424  Q
    | ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||    
T  54833239 ctgcattgataggagcaacagtggccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacct 54833140  T
Q  425 ctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    ||| || ||| | || || |||||| ||||||| || |||||    
T  54833139 cttcgacgcactcgcagaagattcagctttctcaaacacaat 54833098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 5005825 - 5005527
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  5005825 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 5005726  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| || || ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  5005725 tttgagctgcattgatgggagcaacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 5005626  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| || | | | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  5005625 atacctcttcgacgtactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5005527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 252 - 517
Target Start/End: Complemental strand, 14098463 - 14098198
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  14098463 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 14098364  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||| | ||||||||| |    
T  14098363 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcatttacagaggattcagc 14098264  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  14098263 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 14098198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 17014163 - 17014020
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  17014163 atcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctttggagtaaagtcggaagc 17014064  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  17014063 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 17014020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 219 - 434
Target Start/End: Complemental strand, 30753697 - 30753482
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| ||||||  || ||||| ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  30753697 acgggcacttgaggttgacccggcggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 30753598  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || | |||||| ||||| |||||||||||||| || || || |||||    
T  30753597 tttgagctgcattgataggtgcaacagtagccatggattgaccggctccagctgacatcatccccacttccgtttctttcttcttgtggtgtccattacc 30753498  T
Q  419 gtacctctttgatgca 434  Q
     |||||||| ||||||    
T  30753497 atacctcttcgatgca 30753482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 31126867 - 31127049
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  31126867 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 31126966  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  31126967 ttgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 31127049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 252 - 457
Target Start/End: Original strand, 18800971 - 18801176
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  18800971 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 18801070  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | | |||||||||||| || || |||||||| |||||||||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  18801071 tagcttgaccggctccagctgacaccatccccacttctgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 18801170  T
Q  452 tttctc 457  Q
    ||||||    
T  18801171 tttctc 18801176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 14763412 - 14763555
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  14763412 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 14763511  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  14763512 aactcagcatataacatcggtatcggagggaaagtaggtctagc 14763555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 24592443 - 24592565
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  24592443 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 24592542  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  24592543 atcggagggaaagtaggtctagc 24592565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 219 - 457
Target Start/End: Original strand, 33674126 - 33674364
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| ||||||  || || || |||||||| || |||||||| ||||| ||||||||||||||  ||   || ||||| ||||||   |    
T  33674126 acgggcacttgaggttgacccggcggcagggggtactgatggtaaaatggtgggaagaacggatgctgagagtacggcatgtatgggtatgacggaggca 33674225  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  33674226 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 33674325  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctc 457  Q
     || ||||| || |||||| | ||||||||| |||||||    
T  33674326 atatctcttcgacgcatttacagaggattcagctttctc 33674364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 252 - 505
Target Start/End: Original strand, 40105987 - 40106240
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  40105987 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 40106086  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || |  ||||||||||| || |||||| | |  || |||||| |    
T  40106087 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtctattaccgtaccttttcgatgcactcgtagaagattcagc 40106186  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 505  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| ||||||||    
T  40106187 tttctcaaacacaatgattccatccctgactgcttcctcaagacgggtccccat 40106240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 219 - 434
Target Start/End: Complemental strand, 21969656 - 21969441
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || || || ||||||||||||||||| ||  ||  ||| ||||| | ||||   |    
T  21969656 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 21969557  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||| ||||| || || || |||||    
T  21969556 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttcttttttcttgtggtgtccattacc 21969457  T
Q  419 gtacctctttgatgca 434  Q
     |||||||| ||||||    
T  21969456 atacctcttcgatgca 21969441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 14098683 - 14098561
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  14098683 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 14098584  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || ||||||||||||||||||||    
T  14098583 ataggaggaaaagtaggtctagc 14098561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 14665160 - 14665038
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  14665160 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagttggaagcaactcagcatacaacatcggt 14665061  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  14665060 atcggagggaaagtaggtctagc 14665038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 5006036 - 5005893
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||| ||||| ||||| || ||||||||  | |||| ||| || ||     
T  5006036 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccttgtctagttgtacaatgccctctctggagtaaagttggaagc 5005937  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  5005936 aactcagcatataacatcggtatcggagggaaagtaggcctagc 5005893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 6570016 - 6569873
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  6570016 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 6569917  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |  || ||||| | ||||||||||||||| ||||||||||||||    
T  6569916 agttctgcatacaacattggtatcggagggaaagtaggtctagc 6569873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 27163446 - 27163568
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  27163446 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 27163545  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  27163546 atcggagggaaagtaggcctagc 27163568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 35 - 156
Target Start/End: Original strand, 18800742 - 18800863
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||| | |||||||    
T  18800742 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatacaacattggt 18800841  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  18800842 ataggaggaaaagttggtctag 18800863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 30753896 - 30753777
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  30753896 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 30753797  T
Q  135 atcggaggaaaagtaggtct 154  Q
    || ||||||||||| |||||    
T  30753796 ataggaggaaaagttggtct 30753777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 327 - 466
Target Start/End: Complemental strand, 39850470 - 39850331
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || ||||| || ||||    
T  39850470 gcattgataggtgcaacagtagccattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatatctct 39850371  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | || | |||  | ||||||||| ||||||| || |||||    
T  39850370 tcgacgtattcacagaggattcagctttctcaaacacaat 39850331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 31126647 - 31126769
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||| | |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  31126647 gaaccttggaggcaacgggtcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 31126746  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || |||||||||||||| |||||    
T  31126747 ataggaggaaaagtaggcctagc 31126769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 14 - 154
Target Start/End: Original strand, 33673906 - 33674046
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||| |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || ||     
T  33673906 atcacatttgagatcagacctgaaccttggaggcaacgggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagc 33674005  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||    
T  33674006 aactcagcatacaacattggtataggaggaaaagttggtct 33674046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 14 - 156
Target Start/End: Original strand, 36344623 - 36344765
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  36344623 atcacatttgagatcagacctgaacctcggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 36344722  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  36344723 agctctgcatacaacataggtataggaggaaaagttggtctag 36344765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 40105767 - 40105889
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || |  || ||||||| ||| |||    
T  40105767 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagaagttcagcatataacatcggt 40105866  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  40105867 atcggagggaaagtaggcctagc 40105889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 208 - 356
Target Start/End: Complemental strand, 24112631 - 24112483
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
T  24112631 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 24112532  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 356  Q
     |||||    ||||| |||||||| | ||| |||||||||||| |||||    
T  24112531 ggacgggggaaactgagcagcattgacaggagcaacagtagccttggat 24112483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 208 - 356
Target Start/End: Original strand, 34189262 - 34189410
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
T  34189262 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 34189361  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 356  Q
     |||||    ||||| |||||||| ||||| || ||||||||| |||||    
T  34189362 ggacgggggaaactgagcagcattgataggagcgacagtagccttggat 34189410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 24112824 - 24112682
Alignment:
Q  15 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 114  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  24112824 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 24112725  T
Q  115 actcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  24112724 gctctgcatacaacattggtataggaggaaaagttggtctagc 24112682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 157
Target Start/End: Original strand, 34189069 - 34189211
Alignment:
Q  15 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 114  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  34189069 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 34189168  T
Q  115 actcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  34189169 gctctgcatacaacattggtataggaggaaaagttggtctagc 34189211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 156
Target Start/End: Complemental strand, 54833550 - 54833408
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| ||||||||||| || ||||| || ||||||||  | |||| ||| || ||     
T  54833550 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgcctagttgtacaatgccctctttggagtaaagttggaaga 54833451  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  54833450 agctctgcatacaacataggtataggaggaaaagttggtctag 54833408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 39850758 - 39850661
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  39850758 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 39850661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124 (Bit Score: 254; Significance: 1e-141; HSPs: 4)
Name: scaffold0124
Description:

Target: scaffold0124; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 197 - 518
Target Start/End: Complemental strand, 20374 - 20053
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  20374 catttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatgatggaaagaagggatgctgagagtatggc 20275  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20274 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 20175  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||    
T  20174 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaacacaataatgccttctctgacagcttcttctaggcg 20075  T
Q  497 agtccccatgatgtccatctca 518  Q
    |||||||||| || ||||||||    
T  20074 agtccccatggtgaccatctca 20053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 20543 - 20393
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20543 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 20444  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||| ||||| | |||||||||||| ||||| |||||||||||    
T  20443 cgggagtaactcagcatacaacattggtatcgggggaaaggtaggtctagc 20393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #3
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 30396 - 30095
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
T  30396 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcgcatatgggtatgacggag 30297  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  30296 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 30197  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||| | ||||||||  | ||||||||  |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  30196 accatacctcctcgatgcattcacagaggattcggctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 30097  T
Q  516 tc 517  Q
    ||    
T  30096 tc 30095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 35 - 82
Target Start/End: Complemental strand, 30579 - 30532
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 82  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  30579 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 30532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 63)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 197 - 506
Target Start/End: Complemental strand, 16041289 - 16040980
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||| ||  |||||||||||||||||| |||||||||  | |||||||||||||||||||||||||||||| ||||||||||||||| ||    
T  16041289 catttgctgaacgacggaattaacgggtacctgaggttgacccgatgacaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 16041190  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16041189 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 16041090  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  16041089 tcttcttatgatgaccgttaccatacctctttgatgcatttacggaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacg 16040990  T
Q  497 agtccccatg 506  Q
    ||| ||||||    
T  16040989 agttcccatg 16040980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 200 - 518
Target Start/End: Original strand, 16450178 - 16450496
Alignment:
Q  200 ttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgca 299  Q
    ||||| ||||| ||| |||| ||||||||||||| |||||||||| | ||||||||||||||| |||||||||||||| |||||||||||||| |||||     
T  16450178 ttgctgaacgacggcattaatgggtacctgaggttgacccgatggcaaaggatactgatgataaaatggtggaaagaagggatgctgagagtactgcgcg 16450277  T
Q  300 tacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttct 399  Q
    |||||||||||||||  ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||    
T  16450278 tacgggtacgacggaggtaactgggcagcattaataggggcaacagtagctatggattgaccggctccggcagataccatccctacttttgtttctttct 16450377  T
Q  400 tcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagt 499  Q
    |||||||||||||||||||||| || |||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  16450378 tcttatgatgaccgttaccgtatctttttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacgagt 16450477  T
Q  500 ccccatgatgtccatctca 518  Q
    ||||||| || ||||||||    
T  16450478 ccccatggtgaccatctca 16450496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 16518615 - 16518916
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    |||||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||||||||||||||||||  ||||||| ||||| ||||||     
T  16518615 ttaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtatgacggag 16518714  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  16518715 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 16518814  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||| | ||||||||| |||| ||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
T  16518815 accatacctctttgatgcatttacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 16518914  T
Q  516 tc 517  Q
    ||    
T  16518915 tc 16518916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 16503579 - 16503880
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    |||||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||||||||||||||||||  ||||||| ||||| ||||||     
T  16503579 ttaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtatgacggag 16503678  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  16503679 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 16503778  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||| ||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
T  16503779 accatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 16503878  T
Q  516 tc 517  Q
    ||    
T  16503879 tc 16503880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 16449985 - 16450135
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| | |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16449985 gatggaaatcacacttgaggtcagaacgaaacctgggaggcaaaggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 16450084  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  16450085 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 16450135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 16041479 - 16041329
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16041479 gatggaaatcacactttaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 16041380  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||||||||| | ||||||||||||||| || |||||||||||    
T  16041379 cgggagtaactcggcatacaacattggtatcggagggaaggtaggtctagc 16041329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 2154517 - 2154216
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||| ||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  2154517 ttaacggatacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 2154418  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  2154417 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 2154318  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| ||  | || ||||  |||||||| |||||||| |||||| || |||||    
T  2154317 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgatttcatccctgacggcttcttccagacgagttcccatggtgaccatc 2154218  T
Q  516 tc 517  Q
    ||    
T  2154217 tc 2154216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 5127936 - 5127635
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||||||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  5127936 ttaacgggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 5127837  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  5127836 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 5127737  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||| ||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  5127736 accatacctcttcgatgcattcacagaggactcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 5127637  T
Q  516 tc 517  Q
    ||    
T  5127636 tc 5127635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 26484850 - 26484700
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  26484850 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 26484751  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  26484750 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 26484700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 10917064 - 10917365
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||| ||||| |||||| |||||| ||| ||||||||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| |||| |     
T  10917064 ttaacaggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacgaag 10917163  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  10917164 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 10917263  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| ||||||| || ||||| ||  | || || |  |||||||| |||||||| |||||| || |||||    
T  10917264 accatacctctttgatgcattcacagaggattcagctttctcaaacacaatgatttcatccctaacggcttcttccagacgagttcccatggtgaccatc 10917363  T
Q  516 tc 517  Q
    ||    
T  10917364 tc 10917365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 2108992 - 2109142
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  2108992 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 2109091  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| ||||||| |||||||||| ||||||| |||||||||||    
T  2109092 cgggagcaactcagcatatatcattggtatcagaggaaaggtaggtctagc 2109142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 2775515 - 2775365
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  2775515 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 2775416  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||  |||| |||||||||||||||||| ||||||| |||||||||||    
T  2775415 cgggagctactcagcatatagcattggtatcagaggaaaggtaggtctagc 2775365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 31088451 - 31088601
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  31088451 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 31088550  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  31088551 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 31088601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 39211010 - 39211160
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| ||||||| |||| ||||||||| ||||||||||||||||||||||||||||    
T  39211010 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaagcttcccctgtctgattgtgcagtgccctctgagaagtagagt 39211109  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  39211110 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 39211160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 11424975 - 11425276
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||||| ||  ||  ||| ||||| ||||||     
T  11424975 ttaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggag 11425074  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  |||||  |||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  11425075 gcatttgggctacattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 11425174  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  11425175 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 11425274  T
Q  516 tc 517  Q
    ||    
T  11425275 tc 11425276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 45733616 - 45733466
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  45733616 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 45733517  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
       |||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  45733516 taagagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 45733466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 18540947 - 18540805
Alignment:
Q  15 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 114  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |    
T  18540947 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagca 18540848  T
Q  115 actcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||| |||||||||||||||||| |||||||||||||||||||    
T  18540847 actcagcatatagcattggtatcagaggaaaagtaggtctagc 18540805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Original strand, 31088651 - 31088775
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  31088651 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 31088750  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  31088751 acgacggaggtagctgagcagcatt 31088775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Complemental strand, 45733416 - 45733292
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  45733416 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 45733317  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  45733316 acgacggaggtagctgagcagcatt 45733292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 219 - 469
Target Start/End: Complemental strand, 45387284 - 45387034
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  45387284 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 45387185  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  45387184 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 45387085  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataat 469  Q
     |||||||| || ||| |||| || |||||| ||||||| || ||||||||    
T  45387084 atacctcttcgacgcacttgcagaagattcagctttctcaaacacaataat 45387034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 5147542 - 5147840
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||||||  ||  ||| || || ||||||   |    
T  5147542 acgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatggatatgacggaggca 5147641  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||  ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  5147642 tttgagctgcattgataggagcaatggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 5147741  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| |||||||| || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  5147742 atacctcttcgatgcattcgcagaagattcagctttctcaaacacaatgatcccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5147840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 16736662 - 16736960
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||||||||||||||| ||  ||  ||| ||||| |||||| | |    
T  16736662 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 16736761  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  16736762 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 16736861  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  16736862 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 16736960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 16751716 - 16752014
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||||||||||||||| ||  ||  ||| ||||| |||||| | |    
T  16751716 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 16751815  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  16751816 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 16751915  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  16751916 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 16752014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 17523473 - 17523175
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||||||||||||||| ||  ||  ||| ||||| |||||| | |    
T  17523473 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 17523374  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  17523373 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 17523274  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  17523273 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 17523175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 17529742 - 17530040
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||||||||||||||| ||  ||  ||| ||||| |||||| | |    
T  17529742 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 17529841  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  17529842 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 17529941  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  17529942 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 17530040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 252 - 517
Target Start/End: Complemental strand, 31124819 - 31124554
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
T  31124819 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 31124720  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||||| || ||||| |||||||| || ||||||||| |    
T  31124719 ttgattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcattcgcagaggattcagc 31124620  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  31124619 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 31124554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 11424791 - 11424913
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||||||||||||||||||||| ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  11424791 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtgcaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 11424890  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  11424891 atcggagggaaagtaggtctagc 11424913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 219 - 457
Target Start/End: Complemental strand, 11441501 - 11441263
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||||| ||  ||   || ||||| ||||||   |    
T  11441501 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 11441402  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  11441401 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 11441302  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctc 457  Q
     || ||||| || |||||| | ||||||||| |||||||    
T  11441301 atatctcttcgacgcatttacagaggattcagctttctc 11441263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 208 - 433
Target Start/End: Original strand, 4145314 - 4145539
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| |||||    
T  4145314 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggta 4145413  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| ||     
T  4145414 tgacggaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtgg 4145513  T
Q  408 tgaccgttaccgtacctctttgatgc 433  Q
    || || ||||| |||||||| |||||    
T  4145514 tgtccattaccatacctcttcgatgc 4145539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 252 - 517
Target Start/End: Original strand, 24592776 - 24593041
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  24592776 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 24592875  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||| | ||||||||| |    
T  24592876 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcatttacagaggattcagc 24592975  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  24592976 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 24593041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 5128141 - 5127998
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| |||||||||||||||||||| ||||| |||||||||||||| || ||||||||  | |||| ||| || ||     
T  5128141 atcacatttgagatcagacctgaaccttggaggcaacggattaggtgggggcttaccctgtctggttgtacaatgccctctatggagtaaagttggaagc 5128042  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||| | ||| ||||||||||||||||||||||||||    
T  5128041 aactcagcatacaacatcggtatcggaggaaaagtaggtctagc 5127998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 252 - 466
Target Start/End: Complemental strand, 9618559 - 9618345
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  9618559 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 9618460  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
T  9618459 ttgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 9618360  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  9618359 tttctcaaacacaat 9618345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 10916883 - 10917005
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  10916883 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 10916982  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  10916983 atcggagggaaagtaggtctagc 10917005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 16503395 - 16503517
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  16503395 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 16503494  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  16503495 atcggagggaaagtaggtctagc 16503517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 16518431 - 16518553
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  16518431 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 16518530  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  16518531 atcggagggaaagtaggtctagc 16518553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 26275329 - 26275511
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  26275329 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 26275428  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||| ||||||    
T  26275429 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctcttcgatgca 26275511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 26435198 - 26434900
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
T  26435198 acgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 26435099  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||| | ||||| |||||||| |||||||| ||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  26435098 tttgagctgcactgataggagcaacagtggccatggactgaccggctcctgctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 26434999  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     || ||||| | |||| | |  || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  26434998 atatctcttcggtgcactcgtagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 26434900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 252 - 432
Target Start/End: Original strand, 26320104 - 26320284
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  26320104 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 26320203  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatg 432  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||| ||||    
T  26320204 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctcttcgatg 26320284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 5147334 - 5147477
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  5147334 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 5147433  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||||||||||||||||||    
T  5147434 aactcagcatataacatcggtatcggaggaaaagtaggtctagc 5147477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 327 - 434
Target Start/End: Complemental strand, 3445127 - 3445020
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  3445127 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 3445028  T
Q  427 ttgatgca 434  Q
    | ||||||    
T  3445027 tcgatgca 3445020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 219 - 434
Target Start/End: Original strand, 26485946 - 26486161
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
T  26485946 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 26486045  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||| || |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  26486046 tttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 26486145  T
Q  419 gtacctctttgatgca 434  Q
     |||||||| ||||||    
T  26486146 atacctcttcgatgca 26486161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 2154701 - 2154579
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  2154701 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 2154602  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||| |||||||    
T  2154601 atcggagggaaagtatgtctagc 2154579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 16736454 - 16736597
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16736454 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 16736553  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  16736554 aactcagcatataacatcggtatcggagggaaagtaggcctagc 16736597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 16751508 - 16751651
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16751508 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 16751607  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  16751608 aactcagcatataacatcggtatcggagggaaagtaggcctagc 16751651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 17523681 - 17523538
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  17523681 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 17523582  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  17523581 aactcagcatataacatcggtatcggagggaaagtaggcctagc 17523538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 17529534 - 17529677
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  17529534 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 17529633  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  17529634 aactcagcatataacatcggtatcggagggaaagtaggcctagc 17529677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 219 - 466
Target Start/End: Original strand, 26538075 - 26538322
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
T  26538075 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 26538174  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
T  26538175 tttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 26538274  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  26538275 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 26538322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 4145138 - 4145260
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  4145138 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 4145237  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  4145238 atcggagggaaagtaggcctagc 4145260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 9618779 - 9618657
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9618779 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9618680  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  9618679 atcggagggaaagtaggcctagc 9618657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 26275109 - 26275231
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26275109 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26275208  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  26275209 atcggagggaaagtaggcctagc 26275231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 26319884 - 26320006
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26319884 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26319983  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  26319984 atcggagggaaagtaggcctagc 26320006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 252 - 466
Target Start/End: Original strand, 26670149 - 26670363
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| ||||| |    
T  26670149 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcta 26670248  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
T  26670249 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 26670348  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  26670349 tttctcaaacacaat 26670363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 45387471 - 45387349
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  45387471 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 45387372  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  45387371 atcggagggaaagtaggcctagc 45387349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 208 - 356
Target Start/End: Complemental strand, 5159474 - 5159326
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
T  5159474 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 5159375  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 356  Q
     |||||    ||||| |||||||| ||||| ||||||||||||||||||    
T  5159374 ggacgggggaaactgagcagcattgataggagcaacagtagccatggat 5159326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 3445434 - 3445315
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  3445434 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 3445335  T
Q  135 atcggaggaaaagtaggtct 154  Q
    || ||||||||||| |||||    
T  3445334 ataggaggaaaagttggtct 3445315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 26435406 - 26435263
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  26435406 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 26435307  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  26435306 agttctgcatacaacattggtataggaggaaaagttggtctagc 26435263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 327 - 434
Target Start/End: Original strand, 31564709 - 31564816
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  31564709 gcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 31564808  T
Q  427 ttgatgca 434  Q
    | ||||||    
T  31564809 tcgatgca 31564816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 26669929 - 26670051
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| || |||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26669929 gaaccttgggggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26670028  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  26670029 atcggagggaaagtaggcctagc 26670051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 156
Target Start/End: Original strand, 31564405 - 31564526
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  31564405 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 31564504  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  31564505 ataggaggaaaagttggtctag 31564526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 26537885 - 26538004
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || |  || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26537885 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgcacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26537984  T
Q  135 atcggaggaaaagtaggtct 154  Q
    || ||||||||||| |||||    
T  26537985 ataggaggaaaagttggtct 26538004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 35 - 148
Target Start/End: Complemental strand, 11441700 - 11441587
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  11441700 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcgtacaacattggt 11441601  T
Q  135 atcggaggaaaagt 148  Q
    || |||||||||||    
T  11441600 ataggaggaaaagt 11441587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 35 - 156
Target Start/End: Complemental strand, 31125048 - 31124927
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  31125048 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 31124949  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  31124948 ataggaggaaaagttggtctag 31124927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 5159667 - 5159525
Alignment:
Q  15 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 114  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  5159667 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 5159568  T
Q  115 actcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  5159567 gctctgcatacaacattggtataggaggaaaagttggtctagc 5159525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 100)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 197 - 519
Target Start/End: Complemental strand, 23892177 - 23891855
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||||||| || ||||||||||||||| |||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||  ||    
T  23892177 catttgctgaacgatggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatgttggaaagaaaggatgctgagagtacggc 23892078  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||| ||||||||||||   |  ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  23892077 gcatatgggtacgacggaggcatttgggcagcattaataggagcaacagtagccatggattgatcggctccggcagataccatccctacttctgtttctt 23891978  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    ||||||||||||| |||||||| |||||||||||||||||  ||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||    
T  23891977 tcttcttatgatgtccgttaccatacctctttgatgcattcacggaggattcaactttctcgaatacaataattccttctctgacagcttcttccagacg 23891878  T
Q  497 agtccccatgatgtccatctcat 519  Q
    |||||||||| || |||||||||    
T  23891877 agtccccatggtgaccatctcat 23891855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 197 - 518
Target Start/End: Complemental strand, 25199003 - 25198682
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||| |||||||||| ||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||  ||    
T  25199003 catttgctgaacgacggcgttaacgagtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtacggc 25198904  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
    ||||| ||||||||||||   || |||| |||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |    
T  25198903 gcatatgggtacgacggaggcaattgggaagcattaataggagcaacagtagccatggattgaccggctccggcggataccatccctacttctgtttcct 25198804  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    ||||||||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||| |    
T  25198803 tcttcttatgatgtccgttaccgtacctctttgatgcattcacggaggattcaactttctcgaatacaataattccttctctgacagcttcttccagatg 25198704  T
Q  497 agtccccatgatgtccatctca 518  Q
    |||||||||| || ||||||||    
T  25198703 agtccccatggtgaccatctca 25198682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 24688367 - 24688668
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||||||||| |||||||||||||| ||||| ||  ||||||| ||||| ||||||     
T  24688367 ttaacgggtacttgaggttgacccggtggcagagggtactgatgatagaatggcggaaagaaaggatgttgagaatacggcgcatatgggtatgacggag 24688466  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || || ||    
T  24688467 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 24688566  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
T  24688567 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 24688666  T
Q  516 tc 517  Q
    ||    
T  24688667 tc 24688668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 23752660 - 23752961
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  23752660 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 23752759  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  23752760 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 23752859  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  23752860 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 23752959  T
Q  516 tc 517  Q
    ||    
T  23752960 tc 23752961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 30934588 - 30934287
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
T  30934588 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacggag 30934489  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| |||||||||| ||||||||| |||||||||| ||| |||||||||||||| |||||||||||||| || || || ||    
T  30934488 gcatttgggctgcattgataggagcaacagtagtcatggattggccggctccggtagacaccatccctacttccgtttctttcttcttgtggtgtccatt 30934389  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
T  30934388 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 30934289  T
Q  516 tc 517  Q
    ||    
T  30934288 tc 30934287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 22888634 - 22888484
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  22888634 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaaatagagt 22888535  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||| ||||| | ||||||||||||||| || |||||||||||    
T  22888534 cgggagtaactcagcatacaacattggtatcggagggaaggtaggtctagc 22888484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 25199193 - 25199043
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||||||||| |||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25199193 gatggaaatcacacttgagatcagaacggaacctgggaggtaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 25199094  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||||||||| | |||||||||||||| ||| |||||||||||    
T  25199093 cgggagtaactcggcatacaacattggtatcggagaaaaggtaggtctagc 25199043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 23718198 - 23718500
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  23718198 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 23718297  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  23718298 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 23718397  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagctt-cttctagacgagtccccatgatgtccat 514  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||| |||| |||||||| |||||| || ||||    
T  23718398 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttccttccagacgagttcccatggtgaccat 23718497  T
Q  515 ctc 517  Q
    |||    
T  23718498 ctc 23718500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 323 - 517
Target Start/End: Complemental strand, 24951955 - 24951761
Alignment:
Q  323 ggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtac 422  Q
    ||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||||| |||    
T  24951955 ggcagcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgttaccatac 24951856  T
Q  423 ctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    ||||||||||||||  | ||||||||| |||||||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||||    
T  24951855 ctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatctc 24951761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 11549306 - 11549005
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||||||||||||||||||||| || ||  || |||| ||||| ||||||     
T  11549306 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggtggaaagaaaggatgctgtgaatacggcacatatgggtatgacggag 11549207  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  11549206 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 11549107  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  11549106 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 11549007  T
Q  516 tc 517  Q
    ||    
T  11549006 tc 11549005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 197 - 354
Target Start/End: Complemental strand, 22888444 - 22888287
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| ||||| ||| ||||||| |||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||| ||    
T  22888444 catttgctgaacgacggcattaacggttacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 22888345  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatgg 354  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||    
T  22888344 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatgg 22888287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 23892370 - 23892220
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||| ||  ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23892370 gatggaaatcacatttgaggtcggaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 23892271  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||| || ||||||||||| |  ||||||||||||||||| |||||||||||    
T  23892270 cggaagcaactcggcatacatgattggtatcggaggaaaggtaggtctagc 23892220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 33777439 - 33777138
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  33777439 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 33777340  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  || || ||||| ||||| ||||||||||||||||||||||| ||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  33777339 gcatttgagctgcattgataggagcaacagtagccatggattgaccagctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 33777240  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  33777239 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 33777140  T
Q  516 tc 517  Q
    ||    
T  33777139 tc 33777138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 216 - 516
Target Start/End: Original strand, 22999324 - 22999624
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| ||||||  || ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  22999324 ttaacgggtacttgaggttgacccggcggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 22999423  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  22999424 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 22999523  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  22999524 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 22999623  T
Q  516 t 516  Q
    |    
T  22999624 t 22999624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 13184646 - 13184796
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13184646 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13184745  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  13184746 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 13184796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 33877411 - 33877261
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  33877411 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 33877312  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  33877311 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 33877261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 11325958 - 11325808
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  11325958 gatggaaatcacatttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 11325859  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  11325858 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 11325808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 13440492 - 13440642
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13440492 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13440591  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| |  ||||||| |||||||||| ||||||| |||||||||||    
T  13440592 cgggagtaatttagcatataacattggtatcagaggaaaggtaggtctagc 13440642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 29889080 - 29889230
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||  ||||||||||  ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  29889080 gatggaaatcacatatgaggtcagaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggtggtgcagtgccctctgagaagtagagt 29889179  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
     ||||||| ||| ||||| | |||||||||| ||||||| |||||||||||    
T  29889180 tgggagtagctcagcatacaacattggtatcagaggaaaggtaggtctagc 29889230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Original strand, 13184846 - 13184970
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  13184846 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 13184945  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  13184946 acgacggaggtagctgagcagcatt 13184970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Original strand, 13440692 - 13440816
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  13440692 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 13440791  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  13440792 acgacggaggtagctgagcagcatt 13440816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Complemental strand, 33877211 - 33877087
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  33877211 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 33877112  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  33877111 acgacggaggtagctgagcagcatt 33877087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 219 - 466
Target Start/End: Original strand, 9548756 - 9549003
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  9548756 acgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 9548855  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      ||||| | ||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  9548856 tttgggctgtattgataggagcaacagtggccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 9548955  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     |||||||| |||||| |  | ||||||||| ||||||| || |||||    
T  9548956 atacctcttcgatgcactcacagaggattcagctttctcaaacacaat 9549003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 197 - 331
Target Start/End: Complemental strand, 11325768 - 11325634
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||| ||| ||||| ||| |||||||||||||||||| | ||| |||| | |||||||||||||||||||||||||||||| ||||||||||||||||||    
T  11325768 cattcgctgaacgacggcattaacgggtacctgaggttgtcccaatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 11325669  T
Q  297 gcatacgggtacgacggaaataactgggcagcatt 331  Q
    ||||||| ||||||||||  || ||| ||||||||    
T  11325668 gcatacgtgtacgacggaggtagctgagcagcatt 11325634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 15658973 - 15659271
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || || || |||||||||||||||||||| ||  || |||| || || ||||||   |    
T  15658973 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaacggcggaaagaaaggatgctgagaatacggcacatatggatatgacggaggca 15659072  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  15659073 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 15659172  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  15659173 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 15659271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 457
Target Start/End: Complemental strand, 41674658 - 41674420
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||||  ||  || |||| ||||| ||||||   |    
T  41674658 acgggtacttgaggtggacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagcatacggcacatatgggtatgacggaggca 41674559  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      ||||| | ||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  41674558 tttgggctgtattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 41674459  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctc 457  Q
     |||||||| || |||||  | ||||||||  |||||||    
T  41674458 atacctcttcgacgcattcacagaggattcggctttctc 41674420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 219 - 466
Target Start/End: Complemental strand, 31431377 - 31431130
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
T  31431377 acgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggca 31431278  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||||||||  |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  31431277 tttgagctgcattgataggagcaacagtagccacagattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattacc 31431178  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
T  31431177 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 31431130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 252 - 466
Target Start/End: Complemental strand, 2510967 - 2510753
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| ||||| |||||||    
T  2510967 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggagcaacggtagcca 2510868  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    |||||||||||||||| || |||||||| || ||||| |||||||||||||| || || || ||||| ||||||||||||||| |  | ||||||||| |    
T  2510867 tggattgaccggctccagctgataccattcccacttccgtttctttcttcttgtggtgtccattaccatacctctttgatgcactcacagaggattcagc 2510768  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  2510767 tttctcaaacacaat 2510753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 219 - 433
Target Start/End: Original strand, 8665688 - 8665902
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||  ||||| ||||||||||| ||||| |||||||||||||||||||| ||  ||  ||| ||||| | ||||   |    
T  8665688 acgggcacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 8665787  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  8665788 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 8665887  T
Q  419 gtacctctttgatgc 433  Q
     |||||||| |||||    
T  8665888 atacctcttcgatgc 8665902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 23752455 - 23752598
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| |||||||| ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  23752455 atcacatttgaggtcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagc 23752554  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  23752555 aactcagcatataacatcggtatcggagggaaagtaggtctagc 23752598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 219 - 466
Target Start/End: Complemental strand, 30168418 - 30168171
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |    
T  30168418 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggca 30168319  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| || || |||| |||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  30168318 tttgagctgcattgatgggagcaatagtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 30168219  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
T  30168218 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 30168171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 252 - 466
Target Start/End: Complemental strand, 9317367 - 9317153
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  9317367 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 9317268  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| ||||||||||||||| |  | ||||||||| |    
T  9317267 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctctttgatgcactcacagaggattcagc 9317168  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  9317167 tttctcaaacacaat 9317153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 11549490 - 11549368
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  11549490 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 11549391  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  11549390 atcggagggaaagtaggtctagc 11549368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 23718014 - 23718136
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  23718014 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 23718113  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  23718114 atcggagggaaagtaggtctagc 23718136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 24681353 - 24681171
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  24681353 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 24681254  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  24681253 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 24681171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 24723880 - 24723698
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  24723880 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 24723781  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  24723780 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 24723698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 30934769 - 30934647
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  30934769 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatataacatcggt 30934670  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  30934669 atcggagggaaagtaggtctagc 30934647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 327 - 505
Target Start/End: Original strand, 40473873 - 40474051
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| |||||||||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||| ||||    
T  40473873 gcattgataggggcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtatctct 40473972  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 505  Q
    | || |||||  | ||||||||| ||||||| || ||||| || || || ||||  |||||||| ||||| || |||||    
T  40473973 tcgacgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcttcaagacgggttcccat 40474051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 43078198 - 43077900
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||||| ||  ||   || ||||||||||||   |    
T  43078198 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtacgacggaggca 43078099  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||||||||| | |||||||||||| |  || |||||||| ||||| |||||||||||||| || || || |||||    
T  43078098 tttgagctgcattgataggtgcaacagtagccatagcttgaccggctccagttgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 43077999  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     || ||||| || |||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  43077998 atatctcttcgacgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcgagacgggttcccatggtgaccatctc 43077900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 252 - 517
Target Start/End: Original strand, 18375658 - 18375923
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| || || |||||||||||||    
T  18375658 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 18375757  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |  || |||||| |    
T  18375758 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcgtagaagattcagc 18375857  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  18375858 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 18375923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 219 - 466
Target Start/End: Original strand, 18500961 - 18501208
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||||| ||  ||   || ||||| ||||||   |    
T  18500961 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 18501060  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  18501061 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 18501160  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  18501161 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 18501208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 3789475 - 3789177
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| ||||||||  | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
T  3789475 acgggcacctgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 3789376  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  3789375 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 3789276  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     || ||||| |||||| |  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  3789275 atatctcttcgatgcactcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 3789177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 12132071 - 12131889
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  12132071 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 12131972  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||| ||||||    
T  12131971 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctcttcgatgca 12131889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 24688183 - 24688305
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| |  || |||    
T  24688183 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaatatcggt 24688282  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  24688283 atcggagggaaagtaggtctagc 24688305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 216 - 314
Target Start/End: Complemental strand, 24969976 - 24969878
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacgga 314  Q
    |||||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||||||||||||||| ||  ||||||| ||||||||||||    
T  24969976 ttaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgggtacgacgga 24969878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 24970154 - 24970032
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  24970154 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 24970055  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  24970054 atcggagggaaagtaggtctagc 24970032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 37771245 - 37771427
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| || |||||||||   |  || || ||||| ||||| |||||||||||||    
T  37771245 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggatacgacggaggcatttgagctgcattgataggtgcaacagtagcca 37771344  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  37771345 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 37771427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 252 - 517
Target Start/End: Complemental strand, 5637826 - 5637561
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  5637826 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 5637727  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
T  5637726 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 5637627  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  5637626 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5637561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 252 - 469
Target Start/End: Original strand, 15759103 - 15759320
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  15759103 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 15759202  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||| ||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| || ||| |||| || |||||| |    
T  15759203 ttgattgacctgctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgacgcacttgcagaagattcagc 15759302  T
Q  452 tttctcgaatacaataat 469  Q
    |||||| || ||||||||    
T  15759303 tttctcaaacacaataat 15759320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 252 - 517
Target Start/End: Complemental strand, 30151934 - 30151669
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| || || |||||||||||||    
T  30151934 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 30151835  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |  || |||||| |    
T  30151834 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcgtagaagattcagc 30151735  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  30151734 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 30151669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 252 - 505
Target Start/End: Original strand, 37358901 - 37359154
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
T  37358901 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 37359000  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | |  || |||||| |    
T  37359001 tagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgtagaagattcagc 37359100  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 505  Q
    |||||| |||||||| || || |||||||  ||||| || ||||| || |||||    
T  37359101 tttctcaaatacaatgatcccatctctgactgcttcctcaagacgggttcccat 37359154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 327 - 466
Target Start/End: Complemental strand, 6874143 - 6874004
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  6874143 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 6874044  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    |||||||| |  | ||||||||| ||||||| || |||||    
T  6874043 ttgatgcactcacagaggattcagctttctcaaacacaat 6874004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 33777644 - 33777501
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| |||||||| ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  33777644 atcacatttgaggtcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 33777545  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  33777544 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 33777501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 2511187 - 2511065
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  2511187 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 2511088  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  2511087 atcggagggaaagtaggcctagc 2511065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 8665501 - 8665623
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  8665501 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 8665600  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  8665601 atcggagggaaagtaggcctagc 8665623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 15758883 - 15759005
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  15758883 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 15758982  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  15758983 atcggagggaaagtaggcctagc 15759005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 466
Target Start/End: Complemental strand, 26480308 - 26480094
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  26480308 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 26480209  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
T  26480208 ttgattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 26480109  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  26480108 tttctcaaacacaat 26480094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 31826665 - 31826847
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  31826665 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 31826764  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  31826765 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 31826847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 33516272 - 33516090
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
T  33516272 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagccgcattgatgggagcaacggtagcca 33516173  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  33516172 tggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 33516090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 466
Target Start/End: Complemental strand, 34616437 - 34616223
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||||||    
T  34616437 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggtgcaacagtagcca 34616338  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | | |||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
T  34616337 tagcttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 34616238  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  34616237 tttctcaaacacaat 34616223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 37671738 - 37671920
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
T  37671738 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 37671837  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  37671838 tagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 37671920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 6874462 - 6874319
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  6874462 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 6874363  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    | ||| ||||||| ||| ||||||||||| |||||||| |||||    
T  6874362 agctcagcatataacatcggtatcggagggaaagtaggcctagc 6874319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 9548548 - 9548691
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||||||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  9548548 atcacacttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 9548647  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
T  9548648 aattcagcatataacatcggtatcggagggaaagtaggtctagc 9548691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 22999119 - 22999262
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||||||||| || ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| ||| || ||     
T  22999119 atcacacttgagatcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagttggaagc 22999218  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  22999219 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 22999262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 327 - 466
Target Start/End: Complemental strand, 37754809 - 37754670
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  37754809 gcattgataggtgcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 37754710  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | || ||| |||| || |||||| ||||||| || |||||    
T  37754709 tcgacgcacttgcagaagattcagctttctcaaacacaat 37754670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 26480528 - 26480406
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26480528 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26480429  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  26480428 atcggagggaaagtaggcctagc 26480406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 32599715 - 32599897
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||| ||    
T  32599715 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagtca 32599814  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| ||||| |||||||| || || || ||||| |||||||| ||||||    
T  32599815 ttgattgaccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtccattaccatacctcttcgatgca 32599897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 14 - 156
Target Start/End: Original strand, 37671488 - 37671630
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || |||||||| |||||  | |||| ||| || ||     
T  37671488 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagc 37671587  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
T  37671588 aactcagcatacaacattggtataggaggaaaagttggtctag 37671630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 15658765 - 15658908
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  15658765 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 15658864  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
T  15658865 aactcagcatataacatcggtattggagggaaagtaggtctagc 15658908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 41674866 - 41674723
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  41674866 atcacatttgagatcagatctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 41674767  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
T  41674766 aattcagcatataacatcggtatcggagggaaagtaggtctagc 41674723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 5638046 - 5637924
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5638046 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 5637947  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  5637946 atcggagggaaagtaggcctagc 5637924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 9317587 - 9317465
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9317587 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9317488  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  9317487 atcggagggaaagtaggcctagc 9317465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 12132291 - 12132169
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  12132291 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 12132192  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  12132191 atcggagggaaagtaggcctagc 12132169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 156
Target Start/End: Original strand, 18500735 - 18500877
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || ||     
T  18500735 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctttggagtaaagttggaagc 18500834  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    ||||| ||||||| ||| ||||| ||||||||||| |||||||    
T  18500835 aactcagcatataacatcggtataggaggaaaagttggtctag 18500877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 156
Target Start/End: Complemental strand, 28649392 - 28649250
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || ||     
T  28649392 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagc 28649293  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
T  28649292 aactcagcatacaacattggtataggaggaaaagttggtctag 28649250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 28960044 - 28960226
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  |||||  |||| ||||| ||||||||||||     
T  28960044 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctacattgataggtgcaacagtagccg 28960143  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  28960144 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 28960226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 30152154 - 30152032
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  30152154 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 30152055  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  30152054 atcggagggaaagtaggcctagc 30152032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 30168605 - 30168483
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  30168605 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 30168506  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  30168505 atcggagggaaagtaggcctagc 30168483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 34616654 - 34616532
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || ||||| ||||| | |||||||    
T  34616654 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagcaactcagcatacaacattggt 34616555  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || ||||||||||| ||||||||    
T  34616554 ataggaggaaaagttggtctagc 34616532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 252 - 457
Target Start/End: Complemental strand, 28649142 - 28648937
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |  || || | ||| ||||  |||||||||||||    
T  28649142 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgtattgatagttgcaacagtagcca 28649043  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | | |||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  28649042 tagcttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 28648943  T
Q  452 tttctc 457  Q
    ||||||    
T  28648942 tttctc 28648937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 252 - 457
Target Start/End: Original strand, 29967312 - 29967517
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  29967312 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 29967411  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | ||||| |||||||| || || |||||||| ||||| ||||||||||| || || || || ||||| || ||||| || |||||  | ||||||||| |    
T  29967412 ttgattgcccggctccagctgacaccatccccacttccgtttctttctttttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 29967511  T
Q  452 tttctc 457  Q
    ||||||    
T  29967512 tttctc 29967517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 252 - 457
Target Start/End: Complemental strand, 30029331 - 30029126
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  30029331 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 30029232  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | ||||| |||||||| || || |||||||| ||||| ||||||||||| || || || || ||||| || ||||| || |||||  | ||||||||| |    
T  30029231 ttgattgcccggctccagctgacaccatccccacttccgtttctttctttttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 30029132  T
Q  452 tttctc 457  Q
    ||||||    
T  30029131 tttctc 30029126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 35 - 148
Target Start/End: Complemental strand, 31431576 - 31431463
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  31431576 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 31431477  T
Q  135 atcggaggaaaagt 148  Q
    || |||||||||||    
T  31431476 ataggaggaaaagt 31431463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 327 - 466
Target Start/End: Original strand, 13325165 - 13325304
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| ||||| |||||||| |||||||| ||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  13325165 gcattgataggagcaacggtagccattgattgaccagctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 13325264  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
T  13325265 tcgatgcactcacagaggattcagctttctcaaacacaat 13325304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 31826433 - 31826552
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  31826433 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 31826532  T
Q  135 atcggaggaaaagtaggtct 154  Q
    || ||||||||||| |||||    
T  31826533 ataggaggaaaagttggtct 31826552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 18375438 - 18375560
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || |  || ||||| | |||||||    
T  18375438 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagaagatctgcatacaacattggt 18375537  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || ||||||||||||||||||||    
T  18375538 ataggaggaaaagtaggtctagc 18375560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 28959812 - 28959934
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  28959812 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 28959911  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || ||||||||||| ||||||||    
T  28959912 ataggaggaaaagttggtctagc 28959934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 156
Target Start/End: Original strand, 37770992 - 37771134
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || || |||||  | |||| ||| || ||     
T  37770992 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgacctctctggagtaaagttggaagc 37771091  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
T  37771092 aactcagcatacaacattggtataggaggaaaagttggtctag 37771134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 156
Target Start/End: Original strand, 37358669 - 37358790
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  37358669 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttccgcatacaacattggt 37358768  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  37358769 ataggaggaaaagttggtctag 37358790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 208 - 356
Target Start/End: Complemental strand, 33292488 - 33292340
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
T  33292488 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 33292389  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 356  Q
     |||||    ||||| |||||||| ||||| |||||||||||| |||||    
T  33292388 ggacgggggaaactgagcagcattgataggagcaacagtagccttggat 33292340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 32599477 - 32599620
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  32599477 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 32599576  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  32599577 agttctgcatacaacattggtataggaggaaaagttggtctagc 32599620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 35 - 156
Target Start/End: Complemental strand, 3789677 - 3789556
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || |  || ||||| | |||||||    
T  3789677 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 3789578  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  3789577 ataggaggaaaagttggtctag 3789556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 35 - 156
Target Start/End: Complemental strand, 37755116 - 37754995
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  37755116 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgacctctctggagtaaagttggaagcaactcagcatacaacattggt 37755017  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  37755016 ataggaggaaaagttggtctag 37754995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 14 - 154
Target Start/End: Complemental strand, 43078409 - 43078269
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || || || ||||||||  | |||||||| || ||     
T  43078409 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtacaatgccctctctggagtagagttggaaga 43078310  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
T  43078309 agttctgcatacaacattggtataggaggaaaagttggtct 43078269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 33292681 - 33292539
Alignment:
Q  15 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 114  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  33292681 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 33292582  T
Q  115 actcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  33292581 gctctgcatacaacattggtataggaggaaaagttggtctagc 33292539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 33516492 - 33516370
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  33516492 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 33516393  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || |||||||||||||| |||||    
T  33516392 ataggaggaaaagtaggcctagc 33516370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 24681554 - 24681457
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  24681554 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 24681457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 24724081 - 24723984
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  24724081 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 24723984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 57 - 154
Target Start/End: Original strand, 40473597 - 40473694
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  40473597 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 40473694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 156
Target Start/End: Original strand, 13324835 - 13324976
Alignment:
Q  15 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 114  Q
    ||||| ||||| |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  13324835 tcacatttgagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 13324934  T
Q  115 actcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
      || ||||| | ||||||||| ||||||||||| |||||||    
T  13324935 gttctgcatacaacattggtataggaggaaaagttggtctag 13324976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 162; Significance: 3e-86; HSPs: 43)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 16283392 - 16283091
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    |||| ||||||||||||| |||| | ||| | |||||||| |||||||||||| |||||||||||||||||||||||  ||||||| ||||||||||||     
T  16283392 ttaatgggtacctgaggttgacctggtggcaaaggatactaatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtacgacggag 16283293  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  16283292 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 16283193  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||||||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
T  16283192 accatacctctttgatgcattcacagaggattcagctttctcgaatacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 16283093  T
Q  516 tc 517  Q
    ||    
T  16283092 tc 16283091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 16277497 - 16277196
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  ||||||| ||||| ||||||     
T  16277497 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 16277398  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  16277397 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 16277298  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
T  16277297 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 16277198  T
Q  516 tc 517  Q
    ||    
T  16277197 tc 16277196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 19688041 - 19687740
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||| ||||||||||| ||||||||||||||||| || ||  ||||||| ||||| ||||||     
T  19688041 ttaacgggtacttgaggttgacccggtggcagagggtactggtgatagaatggcggaaagaaaggatgctgggaatacggcgcatatgggtatgacggag 19687942  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||||||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| || || || ||    
T  19687941 gcatttgggcagcattgataggagcaacagtagccatggattgaccggctccggctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 19687842  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| ||||| || |||||| || |||||    
T  19687841 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgggttcccatggtgaccatc 19687742  T
Q  516 tc 517  Q
    ||    
T  19687741 tc 19687740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 197 - 518
Target Start/End: Original strand, 22081125 - 22081446
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| | | ||||| || ||||||||||||||| ||||||  | | | |||||||| ||||| |||||||| ||||||||||||||||||||||||    
T  22081125 catttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgc 22081224  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
       ||| | |||| ||||  || ||| |||||||| || ||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||    
T  22081225 atgtactgatacggcggaggtagctgagcagcattgatgggggcaacagtagccatggattgactggttccggcagataccatccctacttctgtctctt 22081324  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||||| || || ||| || ||||||||||||| |||||||||  ||| || || ||||||||||| ||||||| ||| |||||||  ||    
T  22081325 tcttcttatgatgaccattgccatacttccttgatgcatttgcagaggattcacatttttcaaacacaataatgccatctctgacagcctcttctaagcg 22081424  T
Q  497 agtccccatgatgtccatctca 518  Q
     || |||||| || ||||||||    
T  22081425 ggttcccatggtgaccatctca 22081446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 2137531 - 2137832
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||  |||||||||||||||||||| ||  ||||||| ||||| ||||||     
T  2137531 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatgacggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 2137630  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  2137631 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 2137730  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || | ||| ||||  ||||| || ||||| || |||||| || |||||    
T  2137731 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattcattccctgacggcttcctccagacgggttcccatggtgaccatc 2137830  T
Q  516 tc 517  Q
    ||    
T  2137831 tc 2137832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 14557570 - 14557269
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||| ||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
T  14557570 ttaacaggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacggag 14557471  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| || |||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  14557470 gcatttgggctgcattgataggagcgacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 14557371  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  14557370 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 14557271  T
Q  516 tc 517  Q
    ||    
T  14557270 tc 14557269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 27609177 - 27609478
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||   | |||| ||||| ||||||     
T  27609177 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacgacacatatgggtatgacggag 27609276  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  27609277 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 27609376  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||  |||||||||| ||||| || || || ||||  ||||| || |||||||| |||||| || |||||    
T  27609377 accatacctctttgatgcattcacagaggattcggctttctcgaacacaatgattccatccctgacggcttcctccagacgagttcccatggtgaccatc 27609476  T
Q  516 tc 517  Q
    ||    
T  27609477 tc 27609478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 44563256 - 44563106
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  44563256 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 44563157  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  44563156 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 44563106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 9354777 - 9354627
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||    
T  9354777 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgaggagtagagt 9354678  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  9354677 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 9354627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 19659099 - 19659249
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||| | ||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  19659099 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacgggtcaggtggaggcttgccctgtctggttgtgcagcgccctttgagaagtagagt 19659198  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  19659199 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 19659249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 7 - 154
Target Start/End: Original strand, 22080938 - 22081085
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||| | |||    
T  22080938 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacgggttaggtggaggctttccctgcctggttgtgcagtgccctttgagaagcaaagt 22081037  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    |||||| | |||||| || |||||||||||||||||||| ||||||||    
T  22081038 cgggagcagctcggcgtacagcattggtatcggaggaaaggtaggtct 22081085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 33244820 - 33244670
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| | |||||| |||| | ||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  33244820 gatggaaatcacacttgaggtccgaacggaacttaggaggcgacgggtcaggtggaggcttgccctgtctggttgtgcagcgccctttgagaagtagagt 33244721  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| ||  |||||| |||||||||| ||||||| |||||||||||    
T  33244720 cgggagtaattcaacatataacattggtatcagaggaaaggtaggtctagc 33244670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 207 - 331
Target Start/End: Original strand, 19659299 - 19659423
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  19659299 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 19659398  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  19659399 acgacggaggtagctgagcagcatt 19659423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 216 - 331
Target Start/End: Complemental strand, 44563047 - 44562932
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    |||||||||||||||||| | |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  44563047 ttaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggag 44562948  T
Q  316 ataactgggcagcatt 331  Q
     || ||| ||||||||    
T  44562947 gtagctgagcagcatt 44562932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Complemental strand, 9354577 - 9354453
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  9354577 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 9354478  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  9354477 acgacggaggtagctgagcagcatt 9354453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 18710526 - 18710228
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| ||||||   |    
T  18710526 acgggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggca 18710427  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
T  18710426 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 18710327  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  18710326 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 18710228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 19674378 - 19674080
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||||||||||||||| ||  ||  ||| ||||| ||||||   |    
T  19674378 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 19674279  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| |||||||||||||||| |||||| || || |||||||| || || |||||||||||||| ||||| || |||||    
T  19674278 tttgagctgcattgataggagcaacggtagccatggattgactggctccagctgacaccatccccacgtccgtttctttcttcttgtgatgtccattacc 19674179  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||| || ||| | || || |||||| |||||||||| |||||||| || || ||||  ||||| || ||||| || |||||| || |||||||    
T  19674178 atacctcttcgacgcactcgcagaagattcagctttctcgaacacaataattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 19674080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 225 - 466
Target Start/End: Complemental strand, 19286399 - 19286158
Alignment:
Q  225 acctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactggg 324  Q
    ||||||||| | |||| ||||| ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| ||||||   |  || |    
T  19286399 acctgaggttggcccggtggtaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgag 19286300  T
Q  325 cagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacct 424  Q
    | ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||    
T  19286299 ctgcattgataggagcaacagtggccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacct 19286200  T
Q  425 ctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    ||| || ||| | || || |||||| ||||||| || |||||    
T  19286199 cttcgacgcactcgcagaagattcagctttctcaaacacaat 19286158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 16283604 - 16283454
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || |||||||| || |||| |||    
T  16283604 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctaaggagtaaagt 16283505  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||| || ||||| ||||| | ||| ||||||||||| || |||||||||||    
T  16283504 cggaagcaactcagcatacaacatcggtatcggagggaaggtaggtctagc 16283454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 219 - 457
Target Start/End: Original strand, 31490025 - 31490263
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |    
T  31490025 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggca 31490124  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| |||||||||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  31490125 tttgagctgcattgataggggcaacagtagccattgattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattacc 31490224  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctc 457  Q
     || ||||| || |||||  | ||||||||| |||||||    
T  31490225 atatctcttcgacgcattcacagaggattcagctttctc 31490263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 16277681 - 16277559
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  16277681 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 16277582  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  16277581 atcggagggaaagtaggtctagc 16277559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 208 - 433
Target Start/End: Complemental strand, 31354475 - 31354250
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| |||||    
T  31354475 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggta 31354376  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  ||||| ||||| ||||| ||||| || |||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| ||     
T  31354375 tgacggaggcatttgggctgcattgataggagcaacggtggccatggattgaccggctccagctgataccatccccacttccgtttctttcttcttgtgg 31354276  T
Q  408 tgaccgttaccgtacctctttgatgc 433  Q
    || || ||||| |||||||| |||||    
T  31354275 tgtccattaccatacctcttcgatgc 31354250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 2137347 - 2137469
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  2137347 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 2137446  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  2137447 atcggagggaaagtaggtctagc 2137469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 19688225 - 19688103
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  19688225 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 19688126  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  19688125 atcggagggaaagtaggtctagc 19688103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 27608993 - 27609115
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  27608993 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 27609092  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  27609093 atcggagggaaagtaggtctagc 27609115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 31354672 - 31354529
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| |||||||| |||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  31354672 atcacatttgagatcagacctgaaccttggaggcaaaggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 31354573  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||||||| ||| ||||||||||| |||||||| |||||    
T  31354572 aactcggcatataacatcggtatcggagggaaagtaggcctagc 31354529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 14557751 - 14557629
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| ||| |  |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| |||||||    
T  14557751 gaaccttggaggcaacggatcaggcgagggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacattggt 14557652  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  14557651 atcggagggaaagtaggtctagc 14557629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 19208668 - 19208850
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  19208668 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 19208767  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||| |||| ||||||    
T  19208768 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacttcttcgatgca 19208850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 466
Target Start/End: Original strand, 28362263 - 28362477
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
T  28362263 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 28362362  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    |||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
T  28362363 tggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 28362462  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  28362463 tttctcaaacacaat 28362477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 252 - 505
Target Start/End: Original strand, 3329827 - 3330080
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||  ||||||    
T  3329827 tactgatgataaaacggtgggaagaatggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacgatagcca 3329926  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  3329927 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 3330026  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 505  Q
    |||||| || ||||| || || || ||||  ||||| || |||||||| |||||    
T  3330027 tttctcaaacacaatgattccatccctgacggcttcctcaagacgagttcccat 3330080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 252 - 505
Target Start/End: Complemental strand, 29829220 - 29828967
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
T  29829220 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 29829121  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  29829120 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 29829021  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 505  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||    
T  29829020 tttctcaaacacaatgattccatctctgacggcttcctcaagacgggttcccat 29828967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 19208448 - 19208570
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  19208448 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 19208547  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  19208548 atcggagggaaagtaggcctagc 19208570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 252 - 466
Target Start/End: Original strand, 19518451 - 19518665
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| ||||| || ||||||||||||||||| ||  ||  ||| ||||| ||||||   |  || |  ||||| ||||| |||||||||| ||    
T  19518451 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagttgcattgataggagcaacagtagtca 19518550  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  19518551 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 19518650  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  19518651 tttctcaaacacaat 19518665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 31489838 - 31489960
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  31489838 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 31489937  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  31489938 atcggagggaaagtaggcctagc 31489960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 457
Target Start/End: Complemental strand, 33258630 - 33258425
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  33258630 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 33258531  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  33258530 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgcccattaccatatctcttcgacgcattcacagaggattcagc 33258431  T
Q  452 tttctc 457  Q
    ||||||    
T  33258430 tttctc 33258425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 19674589 - 19674446
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| || ||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  19674589 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggtttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 19674490  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  19674489 aactcagcatataacatcggtatcggagggaaagtaggcctagc 19674446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 28362043 - 28362165
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28362043 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 28362142  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  28362143 atcggagggaaagtaggcctagc 28362165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 35 - 156
Target Start/End: Original strand, 3329595 - 3329716
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  3329595 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 3329694  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  3329695 ataggaggaaaagttggtctag 3329716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 18710734 - 18710591
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||||||||| |||||   |||||| ||||||| ||||| |||||  ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18710734 atcacacttgagatcagacctgaaccttggaggcagcggatcaggtgagggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18710635  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||| | ||||||||| ||||||||||| ||||||||    
T  18710634 aactcagcatacaacattggtataggaggaaaagttggtctagc 18710591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 252 - 517
Target Start/End: Original strand, 12093041 - 12093306
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||| ||||||||    
T  12093041 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcacttgagctgcattgataggagcaatagtagcca 12093140  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | ||||| |||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| || ||||| |||||| | |  || |||||| |    
T  12093141 tagattggccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcgtagaagattcagc 12093240  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
T  12093241 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 12093306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 35 - 156
Target Start/End: Original strand, 12092812 - 12092933
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  12092812 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttccgcatacaacattggt 12092911  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  12092912 ataggaggaaaagttggtctag 12092933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 156
Target Start/End: Complemental strand, 19286610 - 19286468
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| ||||||||||| || ||||| || ||||||||  | |||| ||| || ||     
T  19286610 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgcctagttgtacaatgccctctttggagtaaagttggaaga 19286511  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  19286510 agctctgcatacaacataggtataggaggaaaagttggtctag 19286468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 34 - 156
Target Start/End: Complemental strand, 29829450 - 29829328
Alignment:
Q  34 ggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattgg 133  Q
    ||||||| ||||||||||||| |||||| ||||| ||||||||||| || || ||||||||  | |||| ||| || || |  || || || | ||||||    
T  29829450 ggaaccttggaggcaacggatcaggtgggggcttaccctgtctggtggtacaatgccctctctggagtaaagttggaagaagttctgcgtacaacattgg 29829351  T
Q  134 tatcggaggaaaagtaggtctag 156  Q
    ||| ||||||||||| |||||||    
T  29829350 tataggaggaaaagttggtctag 29829328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089 (Bit Score: 150; Significance: 5e-79; HSPs: 6)
Name: scaffold0089
Description:

Target: scaffold0089; HSP #1
Raw Score: 150; E-Value: 5e-79
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 29706 - 29405
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| | ||| ||||||||||||||||| |||||||||||||||||||| ||  |||||||||||||||| |||     
T  29706 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatacgggtacgatggag 29607  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  29606 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 29507  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||| ||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
T  29506 accatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 29407  T
Q  516 tc 517  Q
    ||    
T  29406 tc 29405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #2
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 40385 - 40683
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||||||||||||| |||||| ||| | ||| |||||||||||||||||  ||||||||||||||||||| ||  ||||||| ||||||| ||||   |    
T  40385 acgggtacctgaggttgacccggtggcaaagggtactgatgatagaatggcagaaagaaaggatgctgagaatacggcgcatatgggtacggcggaggca 40484  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||||||||    
T  40485 tttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgttacc 40584  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| |||||| || |||||||    
T  40585 atacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttcccatggtgaccatctc 40683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #3
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 47298 - 47599
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| || || ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| || |||     
T  47298 ttaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgatggag 47397  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||| | |||||||||||||||| |||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  47398 gcatttgggctgcattgataagagcaacagtagccatgggttgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 47497  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  ||||||||||| |||||||||| ||||| || || || ||||  |||||||| ||||| || |||||| || |||||    
T  47498 accatacctctttgatgcattcacggaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgggttcccatggtgaccatc 47597  T
Q  516 tc 517  Q
    ||    
T  47598 tc 47599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #4
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 29890 - 29768
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  29890 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 29791  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  29790 atcggagggaaagtaggtctagc 29768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #5
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 40198 - 40320
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    ||||||||| |||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  40198 gaacctggggggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 40297  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  40298 atcggagggaaagtaggtctagc 40320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 47114 - 47236
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  47114 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatacaacatcggt 47213  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  47214 atcggagggaaagtaggtctagc 47236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109 (Bit Score: 138; Significance: 7e-72; HSPs: 2)
Name: scaffold0109
Description:

Target: scaffold0109; HSP #1
Raw Score: 138; E-Value: 7e-72
Query Start/End: Original strand, 197 - 518
Target Start/End: Complemental strand, 21529 - 21208
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||||| | | ||||| || ||||||||||||||| ||||||  ||| | |||||||| |||||||||||||| ||||||||||||||||||||||||    
T  21529 catttgctgagcaatggcattgacgggtacctgaggttgacccggcggtggtggatactggtgatagaatggtgggaagaaaggatgctgagagtattgc 21430  T
Q  297 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 396  Q
       ||| |||||| ||||  || ||| | |||||| || |||||||||||||||| |||||||| || ||||||||||||||||||||||||||| ||||    
T  21429 atgtactggtacggcggaggtagctgagaagcattgatgggggcaacagtagccacggattgactggttccggcagataccatccctacttctgtctctt 21330  T
Q  397 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 496  Q
    |||||||||||||||| ||||| ||| || ||||||||||||| ||||||||| ||||||| || |||||||| || ||||||| ||| |||||||  ||    
T  21329 tcttcttatgatgaccattaccatacttccttgatgcatttgcagaggattcacctttctcaaacacaataattccgtctctgacagcctcttctaagcg 21230  T
Q  497 agtccccatgatgtccatctca 518  Q
     || |||||| || ||||||||    
T  21229 ggttcccatggtgaccatctca 21208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109; HSP #2
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 7 - 154
Target Start/End: Complemental strand, 21716 - 21569
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||| | |||||||||||||||||||| |||||||||||||| ||| ||||||| | |||    
T  21716 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacaggttaggtggaggcttgccctgcctggttgtgcagtgtcctttgagaagcaaagt 21617  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    |||||| | |||||||||||||||||||||||||||||| ||||||||    
T  21616 cgggagcagctcggcatatagcattggtatcggaggaaaggtaggtct 21569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 130; Significance: 4e-67; HSPs: 2)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 27235 - 26934
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||||||||| ||||||||||| ||||| |||||||||||||||||||| ||  ||||||| ||||| ||||||     
T  27235 ttaacgggtacttgaggttgacccggtggtagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 27136  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  27135 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 27036  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  27035 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 26936  T
Q  516 tc 517  Q
    ||    
T  26935 tc 26934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 27419 - 27297
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  27419 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 27320  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  27319 atcggagggaaagtaggtctagc 27297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 127; Significance: 2e-65; HSPs: 88)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 210 - 518
Target Start/End: Complemental strand, 20160650 - 20160345
Alignment:
Q  210 atggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacg 309  Q
    ||||| |||||||||||||||||| |||||| |||||||||||||||||| || ||||||||| |||||||||| |||||||| || ||| || |||| |    
T  20160650 atggcattaacgggtacctgaggttgacccggtggtagaggatactgatggtaaaatggtggatagaaaggatgttgagagtaatgtgcaaacaggtatg 20160551  T
Q  310 acggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatg 409  Q
      |||  ||| || | |||||||| ||||||||||||||||||||||||||||||    ||| || ||||||||||||||||||| ||||||||||||||    
T  20160550 gtggaggtaattgagtagcattaacaggggcaacagtagccatggattgaccggca---gcaaattccatccctacttctgtttccttcttcttatgatg 20160454  T
Q  410 accgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatg 509  Q
    ||||||||||||||| |||| |||  |  ||||||||||| |||| || || ||||| || ||||| |||| ||||||||||||||| || |||||| ||    
T  20160453 accgttaccgtacctttttggtgcgctcacggaggattcacctttatcaaacacaatgattccttccctgacagcttcttctagacgggttcccatggtg 20160354  T
Q  510 tccatctca 518  Q
     ||||||||    
T  20160353 accatctca 20160345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 210 - 518
Target Start/End: Original strand, 22172181 - 22172486
Alignment:
Q  210 atggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacg 309  Q
    ||||| |||||||||||||||||| |||||| |||||||||||||||||| || ||||||||| |||||||||| |||||||| || ||| || |||| |    
T  22172181 atggcattaacgggtacctgaggttgacccggtggtagaggatactgatggtaaaatggtggatagaaaggatgttgagagtaatgtgcaaacaggtatg 22172280  T
Q  310 acggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatg 409  Q
      |||  ||| || | |||||||| ||||||||||||||||||||||||||||||    ||| || ||||||||||||||||||| ||||||||||||||    
T  22172281 gtggaggtaattgagtagcattaacaggggcaacagtagccatggattgaccggca---gcaaattccatccctacttctgtttccttcttcttatgatg 22172377  T
Q  410 accgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatg 509  Q
    ||||||||||||||| |||| |||  |  ||||||||||| |||| || || ||||| || ||||| |||| ||||||||||||||| || |||||| ||    
T  22172378 accgttaccgtacctttttggtgcgctcacggaggattcacctttatcaaacacaatgattccttccctgacagcttcttctagacgggttcccatggtg 22172477  T
Q  510 tccatctca 518  Q
     ||||||||    
T  22172478 accatctca 22172486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 13299207 - 13299508
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  ||||||| ||||| ||||||     
T  13299207 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 13299306  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || || || ||    
T  13299307 gcatttgggctgcattgataggagcaacagtagccatggattgaccagctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 13299406  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| || ||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  13299407 accatatctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 13299506  T
Q  516 tc 517  Q
    ||    
T  13299507 tc 13299508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 24863657 - 24863356
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| || ||| ||| || ||||||||| ||||||||||||||||| |||||||||||||||||||| ||  ||||||| ||||| ||||||     
T  24863657 ttaacgggtacttggggttgactcggtggtagagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgggtaggacggag 24863558  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| || || || ||    
T  24863557 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 24863458  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| | |||| || |||||    
T  24863457 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttctcatggtgaccatc 24863358  T
Q  516 tc 517  Q
    ||    
T  24863357 tc 24863356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 15424573 - 15424874
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  ||||||| ||||| ||||||     
T  15424573 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 15424672  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  15424673 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 15424772  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | || |||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| |||||| || |||||    
T  15424773 accatacctctttgatgcattcacagaagattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttcccatggtgaccatc 15424872  T
Q  516 tc 517  Q
    ||    
T  15424873 tc 15424874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 22935136 - 22935434
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||| ||||| ||||| ||  ||||||| ||||| ||||||   |    
T  22935136 acgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaagggatgttgagaatacggcgcatatgggtatgacggaggca 22935235  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      ||||| ||||| ||||| |||||||||| ||||||||||||||| ||||| || |||||||||| ||| |||||||||||||| || || ||||||||    
T  22935236 tttgggctgcattgataggagcaacagtagtcatggattgaccggccccggctgacaccatccctatttccgtttctttcttcttgtggtgtccgttacc 22935335  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||||    
T  22935336 atacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatctc 22935434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 219 - 517
Target Start/End: Original strand, 23857581 - 23857879
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||| ||||| ||||| ||  ||||||| ||||| ||||||   |    
T  23857581 acgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaagggatgttgagaatacggcgcatatgggtatgacggaggca 23857680  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      ||||| ||||| ||||| |||||||||| ||||||||||||||| ||||| || |||||||||| ||| |||||||||||||| || || ||||||||    
T  23857681 tttgggctgcattgataggagcaacagtagtcatggattgaccggccccggctgacaccatccctatttccgtttctttcttcttgtggtgtccgttacc 23857780  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||||    
T  23857781 atacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatctc 23857879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 26988941 - 26988640
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  26988941 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 26988842  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  26988841 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 26988742  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  26988741 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 26988642  T
Q  516 tc 517  Q
    ||    
T  26988641 tc 26988640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 27000013 - 26999712
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  27000013 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 26999914  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  26999913 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 26999814  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  26999813 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 26999714  T
Q  516 tc 517  Q
    ||    
T  26999713 tc 26999712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 22456978 - 22457128
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  22456978 gatggaaatcacacttgaggtaagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccttatgagaagtagagt 22457077  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||||||||| | |||||||||| ||||||| |||||||||||    
T  22457078 cgggagtaactcggcatacatcattggtatcagaggaaaggtaggtctagc 22457128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 22477317 - 22477467
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  22477317 gatggaaatcacacttgaggttagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccatatgagaagtagagt 22477416  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||||||||||||||| | |||||||||| ||||||| |||||||||||    
T  22477417 cgggagtaactcggcatacatcattggtatcagaggaaaggtaggtctagc 22477467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 216 - 466
Target Start/End: Original strand, 24304874 - 24305124
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
T  24304874 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacggag 24304973  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  ||||||||||| ||||| || |||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  24304974 gcatttgggcagcattgataggagcgacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 24305073  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| |||||    
T  24305074 accatacctctttgatgcattcacagaggattcagctttctcgaacacaat 24305124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 27290414 - 27290564
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||| ||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  27290414 gatggaaatcacacttgaggtcagaacggaacttgggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 27290513  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| ||||||| |||||||||| ||||||| |||||||||||    
T  27290514 cgggagcaactcagcatataacattggtatcagaggaaaggtaggtctagc 27290564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 216 - 517
Target Start/End: Complemental strand, 16749794 - 16749493
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  16749794 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 16749695  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
    | |  || || || || ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  16749694 acatttgagctgcgttgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 16749595  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| |||||| |  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  16749594 accatacctcttcgatgcactcacagaggattcagctttctcgaacacaatgatcccatccctgacggcttcctccagacgggttcccatggtgaccatc 16749495  T
Q  516 tc 517  Q
    ||    
T  16749494 tc 16749493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 216 - 360
Target Start/End: Original strand, 22477529 - 22477673
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    |||||||||||||||||| |||||||||| | |||||||| ||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||     
T  22477529 ttaacgggtacctgaggttgacccgatggcaaaggatactaatgatagaatggtggaaagaagggatgctgagagtactgcgcatacgggtacgacagag 22477628  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgac 360  Q
     ||| |||||||||||||| |||||||||||||||||||||||||    
T  22477629 gtaattgggcagcattaattggggcaacagtagccatggattgac 22477673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 219 - 466
Target Start/End: Complemental strand, 26918317 - 26918070
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||   |    
T  26918317 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggaggca 26918218  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || |||||    
T  26918217 tttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 26918118  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     |||||||| ||||||||  | ||||||||| |||||||||| |||||    
T  26918117 atacctcttcgatgcattcacagaggattcagctttctcgaacacaat 26918070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 8892354 - 8892504
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  8892354 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 8892453  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  8892454 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 8892504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 8903589 - 8903739
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  8903589 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 8903688  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  8903689 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 8903739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 13522117 - 13522267
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13522117 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13522216  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  13522217 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 13522267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 14143329 - 14143479
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  14143329 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 14143428  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  14143429 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 14143479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 26788096 - 26787946
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  26788096 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 26787997  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  26787996 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 26787946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 27196469 - 27196319
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  27196469 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 27196370  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  27196369 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 27196319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 27252771 - 27252921
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  27252771 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 27252870  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  27252871 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 27252921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 33374300 - 33374450
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  33374300 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 33374399  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  33374400 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 33374450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 28162809 - 28162659
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| | ||||||||||||||||||||||||||||||||||| |||||||||||||    
T  28162809 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaagtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 28162710  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  28162709 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 28162659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 197 - 331
Target Start/End: Complemental strand, 28162619 - 28162485
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||| ||| ||||| ||| |||||||||||||||||| | |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||    
T  28162619 cattcgctgaacgacggcattaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 28162520  T
Q  297 gcatacgggtacgacggaaataactgggcagcatt 331  Q
    |||||||||||||| |||  || ||| ||||||||    
T  28162519 gcatacgggtacgatggaggtagctgagcagcatt 28162485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Original strand, 13522317 - 13522441
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  13522317 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 13522416  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  13522417 acgacggaggtagctgagcagcatt 13522441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 207 - 331
Target Start/End: Original strand, 33374500 - 33374624
Alignment:
Q  207 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggt 306  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
T  33374500 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 33374599  T
Q  307 acgacggaaataactgggcagcatt 331  Q
    ||||||||  || ||| ||||||||    
T  33374600 acgacggaggtagctgagcagcatt 33374624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 9 - 156
Target Start/End: Complemental strand, 20160851 - 20160704
Alignment:
Q  9 tggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcg 108  Q
    |||| |||||||||||| || |||  |||||||||||| ||||||| ||||||||||||||| || ||||||||||| ||||||||| |||||| ||| |    
T  20160851 tggaaatcacacttgagatcggaacagaacctgggaggtaacggatcaggtggaggcttgccttgcctggttgtgcaatgccctctgtgaagtaaagttg 20160752  T
Q  109 ggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    |||||||||| ||||||| ||| |||||||||||||| ||||||||||    
T  20160751 ggagtaactcagcatataacatcggtatcggaggaaaggtaggtctag 20160704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 9 - 156
Target Start/End: Original strand, 22171980 - 22172127
Alignment:
Q  9 tggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcg 108  Q
    |||| |||||||||||| || |||  |||||||||||| ||||||| ||||||||||||||| || ||||||||||| ||||||||| |||||| ||| |    
T  22171980 tggaaatcacacttgagatcggaacagaacctgggaggtaacggatcaggtggaggcttgccttgcctggttgtgcaatgccctctgtgaagtaaagttg 22172079  T
Q  109 ggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    |||||||||| ||||||| ||| |||||||||||||| ||||||||||    
T  22172080 ggagtaactcagcatataacatcggtatcggaggaaaggtaggtctag 22172127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 197 - 331
Target Start/End: Original strand, 8892544 - 8892678
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||| ||| ||||| ||| |||||||||||||||||| |||||||||| | || |||||||||||| |||||||||||||| ||||||||||||||||||    
T  8892544 cattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatataatggtggaaagaagggatgctgagagtattgc 8892643  T
Q  297 gcatacgggtacgacggaaataactgggcagcatt 331  Q
    ||||||| ||||||||||  || ||| ||||||||    
T  8892644 gcatacgtgtacgacggaggtagctgagcagcatt 8892678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 197 - 331
Target Start/End: Original strand, 8903779 - 8903913
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||| ||| ||||| ||| |||||||||||||||||| |||||||||| | || |||||||||||||||||||||||||||  |||||||||||||||||    
T  8903779 cattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaagagatgctgagagtattgc 8903878  T
Q  297 gcatacgggtacgacggaaataactgggcagcatt 331  Q
    ||||||| ||||||||||  || ||| ||||||||    
T  8903879 gcatacgtgtacgacggaggtagctgagcagcatt 8903913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 208 - 517
Target Start/End: Complemental strand, 29549426 - 29549117
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| |||||    
T  29549426 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 29549327  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| |||    
T  29549326 tgacggaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtga 29549227  T
Q  408 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 507  Q
    || || ||||| |||||||| |||||| |  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || ||||||     
T  29549226 tgtccattaccatacctcttcgatgcactcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 29549127  T
Q  508 tgtccatctc 517  Q
    || |||||||    
T  29549126 tgaccatctc 29549117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 22934924 - 22935074
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||    
T  22934924 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagt 22935023  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||| || ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  22935024 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtctagc 22935074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 23857369 - 23857519
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||    
T  23857369 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagt 23857468  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||| || ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  23857469 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtctagc 23857519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 208 - 517
Target Start/End: Complemental strand, 27044338 - 27044029
Alignment:
Q  208 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggta 307  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| |||||    
T  27044338 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggta 27044239  T
Q  308 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 407  Q
     ||||||   |  ||||| ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  27044238 tgacggaggcatttgggctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 27044139  T
Q  408 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 507  Q
    || || ||||| || ||||| |||||| |  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || ||||||     
T  27044138 tgtccattaccatatctcttcgatgcactcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 27044039  T
Q  508 tgtccatctc 517  Q
    || |||||||    
T  27044038 tgaccatctc 27044029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 7 - 154
Target Start/End: Original strand, 27272624 - 27272771
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| |||||| |||||||| ||   ||||||||||||| |||||| |||||| ||||| |||||||||||||| || ||||||||  | ||||||||    
T  27272624 gatggaaatcacatttgaggtcggacctgaacctgggaggcgacggatcaggtgggggcttaccctgtctggttgtacaatgccctctctggagtagagt 27272723  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||| || ||||| ||||||| ||| ||||||||||| |||||||||||    
T  27272724 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtct 27272771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 219 - 517
Target Start/End: Complemental strand, 3696000 - 3695702
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| || || ||||||||||| || ||||| ||||||||||||||||| ||  ||   || ||||| ||||||   |    
T  3696000 acgggcacttgaggttgacccggtggcagggggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 3695901  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  3695900 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 3695801  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
     || ||||| ||||||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  3695800 atatctcttcgatgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 3695702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 26918525 - 26918382
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  26918525 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagc 26918426  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  26918425 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 26918382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 248 - 434
Target Start/End: Complemental strand, 4525197 - 4525011
Alignment:
Q  248 aggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagta 347  Q
    ||||||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||    
T  4525197 aggatactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagta 4525098  T
Q  348 gccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  4525097 gccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 4525011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 13299023 - 13299145
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  13299023 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 13299122  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  13299123 atcggagggaaagtaggtctagc 13299145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 24304690 - 24304812
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  24304690 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 24304789  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  24304790 atcggagggaaagtaggtctagc 24304812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 26989125 - 26989003
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  26989125 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatataacatcggt 26989026  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  26989025 atcggagggaaagtaggtctagc 26989003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 252 - 517
Target Start/End: Complemental strand, 17025166 - 17024901
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||||||    
T  17025166 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagcca 17025067  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | | |||||||||||| || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||  |    
T  17025066 tagcttgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcggc 17024967  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  17024966 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 17024901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 16749999 - 16749856
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16749999 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagc 16749900  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  16749899 aactcagcatataacatcggtatcggagggaaagtaggtctagc 16749856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 15424389 - 15424511
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  15424389 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 15424488  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  15424489 atcggagggaaagtaggtctagc 15424511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 24863841 - 24863719
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  24863841 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 24863742  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  24863741 atcggagggaaagtaggtctagc 24863719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 27000197 - 27000075
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  27000197 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 27000098  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| ||||||||||||||    
T  27000097 atcggagggaaagtaggtctagc 27000075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 466
Target Start/End: Complemental strand, 27485021 - 27484807
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
T  27485021 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 27484922  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||| ||||| |||||| |  | ||||||||| |    
T  27484921 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtatctcttcgatgcactcacagaggattcagc 27484822  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  27484821 tttctcaaacacaat 27484807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 466
Target Start/End: Complemental strand, 29501310 - 29501096
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||||||||||   |  || || ||||| ||||| ||||| |||||||    
T  29501310 tactgatgataaaacggtgggaagaatggatgctgagaatacggcatatatgggtacgacggaggcatttgagctgcattgataggagcaacggtagcca 29501211  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  |  |||||||| |    
T  29501210 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacaaaggattcagc 29501111  T
Q  452 tttctcgaatacaat 466  Q
    |||||| || |||||    
T  29501110 tttctcaaacacaat 29501096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Complemental strand, 29572917 - 29572735
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  29572917 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 29572818  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
T  29572817 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 29572735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 30558308 - 30558490
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
T  30558308 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 30558407  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  30558408 tggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 30558490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 327 - 434
Target Start/End: Complemental strand, 4757590 - 4757483
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| || ||||||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  4757590 gcattgataggagcgacagtagccattgattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 4757491  T
Q  427 ttgatgca 434  Q
    | ||||||    
T  4757490 tcgatgca 4757483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 327 - 466
Target Start/End: Complemental strand, 4772826 - 4772687
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| ||||| |||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  4772826 gcattgataggagcaacggtagccatagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 4772727  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
T  4772726 tcgatgcactcacagaggattcagctttctcaaacacaat 4772687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 327 - 466
Target Start/End: Complemental strand, 27007541 - 27007402
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27007541 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27007442  T
Q  427 ttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
T  27007441 tcgatgcactcacagaggattcagctttctcaaacacaat 27007402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 219 - 466
Target Start/End: Original strand, 34463620 - 34463867
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||||||||||||||| ||  ||   || ||||| ||||||   |    
T  34463620 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 34463719  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  34463720 tttgagctgcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 34463819  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  34463820 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 34463867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 35 - 156
Target Start/End: Complemental strand, 4525410 - 4525289
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||||| || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4525410 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtgcaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4525311  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  4525310 ataggaggaaaagttggtctag 4525289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 517
Target Start/End: Original strand, 4546076 - 4546341
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
T  4546076 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 4546175  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||| |||||| | |  || |||||| |    
T  4546176 tagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgtagaagattcagc 4546275  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
T  4546276 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 4546341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 457
Target Start/End: Original strand, 16944319 - 16944524
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  16944319 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 16944418  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  16944419 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 16944518  T
Q  452 tttctc 457  Q
    ||||||    
T  16944519 tttctc 16944524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 433
Target Start/End: Original strand, 26777919 - 26778100
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||||||||||||||| ||  ||   || ||||| ||||||   |  ||||| | ||| ||||| |||||||||||||    
T  26777919 tactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggcatttgggctgtattgataggtgcaacagtagcca 26778018  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 433  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
T  26778019 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 26778100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 517
Target Start/End: Complemental strand, 28207346 - 28207081
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
T  28207346 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 28207247  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||| |||||| | |  || |||||| |    
T  28207246 tagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgtagaagattcagc 28207147  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
T  28207146 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 28207081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 29549620 - 29549477
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  29549620 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 29549521  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    | ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  29549520 agctctgcatacaacattggtataggaggaaaagttggtctagc 29549477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 35 - 156
Target Start/End: Complemental strand, 4773130 - 4773009
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4773130 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4773031  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  4773030 ataggaggaaaagttggtctag 4773009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 3696205 - 3696086
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||| | |||||||    
T  3696205 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatacaacattggt 3696106  T
Q  135 atcggaggaaaagtaggtct 154  Q
    || ||||||||||| |||||    
T  3696105 ataggaggaaaagttggtct 3696086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 219 - 466
Target Start/End: Complemental strand, 16674064 - 16673817
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| || || ||||||   |    
T  16674064 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatggatatgacggaggca 16673965  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
      || || ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
T  16673964 tttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 16673865  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  16673864 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 16673817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 327 - 434
Target Start/End: Original strand, 27360377 - 27360484
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27360377 gcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27360476  T
Q  427 ttgatgca 434  Q
    | ||||||    
T  27360477 tcgatgca 27360484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 327 - 434
Target Start/End: Original strand, 27450720 - 27450827
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 426  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27450720 gcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27450819  T
Q  427 ttgatgca 434  Q
    | ||||||    
T  27450820 tcgatgca 27450827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 29573137 - 29573015
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| ||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  29573137 gaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 29573038  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || ||||||||||| ||||||||    
T  29573037 ataggaggaaaagttggtctagc 29573015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 148
Target Start/End: Original strand, 4545847 - 4545960
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || ||||| ||||| | |||||||    
T  4545847 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagcaactcagcatacaacattggt 4545946  T
Q  135 atcggaggaaaagt 148  Q
    || |||||||||||    
T  4545947 ataggaggaaaagt 4545960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 148
Target Start/End: Original strand, 4724206 - 4724319
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  4724206 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 4724305  T
Q  135 atcggaggaaaagt 148  Q
    || |||||||||||    
T  4724306 ataggaggaaaagt 4724319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 252 - 505
Target Start/End: Original strand, 4724435 - 4724688
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
T  4724435 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 4724534  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| ||||| || |||||| | |  || |||||| |    
T  4724535 tagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccataccttttcgatgcactcgtagaagattcagc 4724634  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 505  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||    
T  4724635 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccat 4724688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 156
Target Start/End: Complemental strand, 4757888 - 4757767
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4757888 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4757789  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  4757788 ataggaggaaaagttggtctag 4757767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 148
Target Start/End: Complemental strand, 28207578 - 28207465
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  28207578 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 28207479  T
Q  135 atcggaggaaaagt 148  Q
    || |||||||||||    
T  28207478 ataggaggaaaagt 28207465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 14 - 154
Target Start/End: Complemental strand, 16674284 - 16674144
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  16674284 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 16674185  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    | ||| ||||| | ||||||||| ||||||||||| |||||    
T  16674184 agctctgcatacaacattggtataggaggaaaagttggtct 16674144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 14 - 154
Target Start/End: Original strand, 34463397 - 34463537
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| || ||||| || |||||||| |||||  | |||| ||| || ||     
T  34463397 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggctttccttgtctagtcgtgcagtgtcctctctggagtaaagttggaagc 34463496  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtct 154  Q
    ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  34463497 aactcagcatataacatcggtataggaggaaaagttggtct 34463537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 14 - 156
Target Start/End: Complemental strand, 27007872 - 27007730
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  27007872 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 27007773  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    |  || ||||| | ||||||||| ||||||||||| |||||||    
T  27007772 agttctgcatacaacattggtataggaggaaaagttggtctag 27007730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 14 - 156
Target Start/End: Complemental strand, 27044532 - 27044390
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  27044532 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaaga 27044433  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  27044432 agctctgcatacaacataggtataggaggaaaagttggtctag 27044390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 219 - 505
Target Start/End: Original strand, 27629968 - 27630254
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaata 318  Q
    ||||||||||||||| | || ||||| | |||||| ||||| || || ||||| ||||| ||||||||||| ||| | | | | ||||| |  |||  ||    
T  27629968 acgggtacctgaggtggtcctgatggcaaaggatattgatggtaaaacggtgggaagaatggatgctgagaatatggtgtacaggggtatggtggaggta 27630067  T
Q  319 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 418  Q
     ||| ||| |||||| |||||| ||||||||| | || ||||| ||||| |  |||||||| || || |||||||| |||||||| || || || || ||    
T  27630068 gctgagcaacattaacaggggcgacagtagccgtagactgacctgctcccgaggataccattccaacctctgtttccttcttcttgtggtggccattgcc 27630167  T
Q  419 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 505  Q
     |||||||| ||  || |||  || || ||| | ||||| |||||||| || || |||||||  || || |||||||||||||||||    
T  27630168 atacctcttcgacccacttgtagaagactcacccttctcaaatacaatgataccctctctgacggcctcctctagacgagtccccat 27630254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 333 - 434
Target Start/End: Original strand, 26116792 - 26116893
Alignment:
Q  333 ataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatg 432  Q
    ||||| ||||| ||||| || |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| ||||    
T  26116792 ataggagcaacggtagctatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatg 26116891  T
Q  433 ca 434  Q
    ||    
T  26116892 ca 26116893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 35 - 156
Target Start/End: Complemental strand, 27485253 - 27485132
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  27485253 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 27485154  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  27485153 ataggaggaaaagttggtctag 27485132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 26777687 - 26777809
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  |||||||| | ||| |||    
T  26777687 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttcggcatacaacatcggt 26777786  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || ||||| || || ||||||||    
T  26777787 ataggagggaaggttggtctagc 26777809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 30558088 - 30558210
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  30558088 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 30558187  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || |||||||||||||| |||||    
T  30558188 ataggaggaaaagtaggcctagc 30558210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 35 - 156
Target Start/End: Original strand, 26116482 - 26116603
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || || |||||  | |||| |||||| || |  || ||||| | ||| |||    
T  26116482 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgacctctctggagtaaagtcggaagaagttctgcatacaacatcggt 26116581  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  26116582 ataggaggaaaagttggtctag 26116603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 35 - 156
Target Start/End: Original strand, 27360064 - 27360185
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | ||| |||    
T  27360064 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttctgcatacaacatcggt 27360163  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  27360164 ataggaggaaaagttggtctag 27360185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 35 - 156
Target Start/End: Original strand, 27450407 - 27450528
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | ||| |||    
T  27450407 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttctgcatacaacatcggt 27450506  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||||||||| |||||||    
T  27450507 ataggaggaaaagttggtctag 27450528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 35 - 156
Target Start/End: Complemental strand, 29501539 - 29501418
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  29501539 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 29501440  T
Q  135 atcggaggaaaagtaggtctag 156  Q
    || ||||| || || |||||||    
T  29501439 ataggagggaaggttggtctag 29501418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 57 - 156
Target Start/End: Complemental strand, 17025379 - 17025280
Alignment:
Q  57 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 156  Q
    ||||||||||||||||| || || |||||||| |||||  | |||||||| || || |  || ||||| | ||||||||| ||||||||||| |||||||    
T  17025379 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtagagttggaagaagttctgcatacaacattggtataggaggaaaagttggtctag 17025280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 324 - 505
Target Start/End: Original strand, 27272947 - 27273128
Alignment:
Q  324 gcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacc 423  Q
    |||||||||| |||||| ||||||||  | |  ||||| ||||| |  |||||||| || || |||||||| |||||||| || || || || || ||||    
T  27272947 gcagcattaacaggggcgacagtagctgtagtctgacctgctccagaggataccattccaacctctgtttccttcttcttgtggtggccattgccatacc 27273046  T
Q  424 tctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 505  Q
    ||||  |  ||||||  || || ||| | ||||| |||||||| || ||||| ||||  ||||| |||||||||||||||||    
T  27273047 tcttcaacccatttgtagaagactcacccttctcaaatacaatgataccttccctgacggcttcctctagacgagtccccat 27273128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0558 (Bit Score: 123; Significance: 6e-63; HSPs: 1)
Name: scaffold0558
Description:

Target: scaffold0558; HSP #1
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 129 - 279
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||||    
T  129 gatggaaatcacacttgaggtcagaacggaacctggaaggcaacggatcaggtggaggcttgccatgtctggttgagcagtgccctctgagaagtagagt 228  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  229 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 115; Significance: 4e-58; HSPs: 2)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 2759 - 2909
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 106  Q
    |||||| ||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  2759 gatggaaatcacacttgaggtcagaacggaacctaggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 2858  T
Q  107 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
     ||||||| |||||||||||||||||||||||||||||| |||||||||||    
T  2859 tgggagtagctcggcatatagcattggtatcggaggaaaggtaggtctagc 2909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 197 - 331
Target Start/End: Original strand, 2949 - 3083
Alignment:
Q  197 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 296  Q
    |||||| | ||||| ||| || ||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||    
T  2949 catttgttgaacgacggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 3048  T
Q  297 gcatacgggtacgacggaaataactgggcagcatt 331  Q
    || |||||||||||||||  || ||| ||||||||    
T  3049 gcgtacgggtacgacggaggtagctgagcagcatt 3083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 106; Significance: 8e-53; HSPs: 2)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 216 - 517
Target Start/End: Original strand, 443 - 744
Alignment:
Q  216 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaa 315  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
T  443 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 542  T
Q  316 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 415  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| |  || |||||||||||||| |||||||||||||| || || || ||    
T  543 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagttgacaccatccctacttccgtttctttcttcttgtggtgtccatt 642  T
Q  416 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| ||||| || |||||| || |||||    
T  643 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgggttcccatggtgaccatc 742  T
Q  516 tc 517  Q
    ||    
T  743 tc 744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 258 - 381
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaact-cggcatatagcattgg 133  Q
    |||| |||||||||||||||  ||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||   ||||||| ||| ||    
T  258 gaacttgggaggcaacggatccggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactaaagcatataacatcgg 357  T
Q  134 tatcggaggaaaagtaggtctagc 157  Q
    ||||||||| ||||||||||||||    
T  358 tatcggagggaaagtaggtctagc 381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415 (Bit Score: 74; Significance: 1e-33; HSPs: 3)
Name: scaffold0415
Description:

Target: scaffold0415; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 2018 - 2103
Alignment:
Q  7 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccct 92  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  2018 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccct 2103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 219 - 466
Target Start/End: Complemental strand, 5930 - 5682
Alignment:
Q  219 acgggtacctgaggtagacccgatggtagaggatactgatgatagaat-ggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaat 317  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||  ||||| ||||||||||||||||| ||  ||   || ||||| ||||||       
T  5930 acgggcacttgaggttgacccggtggcagagggtactgatgataaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggc 5831  T
Q  318 aactgggcagcattaataggggcaacagtagccatg-gattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtta 416  Q
    |  || |  ||||| ||||| ||||||||||||||  |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||    
T  5830 atttgagttgcattgataggagcaacagtagccatttgattgaccggctccagctgacaccatccc-acttccgtttctttcttcttgtggtgtccatta 5732  T
Q  417 ccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 466  Q
    || || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  5731 ccatatctcttcgacgcattcacagaggattcagctttctcaaacacaat 5682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 14 - 94
Target Start/End: Complemental strand, 6160 - 6080
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 94  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||    
T  6160 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctct 6080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336 (Bit Score: 70; Significance: 3e-31; HSPs: 2)
Name: scaffold0336
Description:

Target: scaffold0336; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 248 - 517
Target Start/End: Complemental strand, 8143 - 7874
Alignment:
Q  248 aggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagta 347  Q
    ||||||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||    
T  8143 aggatactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagta 8044  T
Q  348 gccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggatt 447  Q
    ||||  |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||||  | |||||||    
T  8043 gccacagattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggatt 7944  T
Q  448 caactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    || ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  7943 cagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 7874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 9714 - 9571
Alignment:
Q  14 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 113  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || ||     
T  9714 atcacatttgagatcagatctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagtcgtacaatgccctctctggagtagagttggaaga 9615  T
Q  114 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 157  Q
    |  || ||||| | ||| ||||| ||||||||||| ||||||||    
T  9614 agttctgcatacaacataggtataggaggaaaagttggtctagc 9571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0099 (Bit Score: 63; Significance: 4e-27; HSPs: 1)
Name: scaffold0099
Description:

Target: scaffold0099; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 323 - 517
Target Start/End: Original strand, 48568 - 48769
Alignment:
Q  323 ggcagcattaataggggcaacag-tagccatggattga--ccggctccggca-gataccatccc-tacttctgtttctttcttcttatgatgacc-gtta 416  Q
    ||||||||| ||||| ||||||| |||||||||||||   |||||||||||| || |||||||| |||||| |||||||||||||| || || || ||||    
T  48568 ggcagcattgataggagcaacaggtagccatggattggacccggctccggcaagacaccatcccctacttccgtttctttcttcttgtggtgtcccgtta 48667  T
Q  417 ccgtacctcttt-gatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 515  Q
    || ||||||||| ||||||||  | ||||||||| |||||||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
T  48668 ccatacctcttttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 48767  T
Q  516 tc 517  Q
    ||    
T  48768 tc 48769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 62; Significance: 1e-26; HSPs: 2)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 252 - 517
Target Start/End: Original strand, 15279 - 15544
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| || || |||||||||||||    
T  15279 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 15378  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |  || |||||| |    
T  15379 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcgtagaagattcagc 15478  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  15479 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 15544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 15059 - 15181
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || |  || ||||| | |||||||    
T  15059 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagaagatctgcatacaacattggt 15158  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    || ||||||||||||||||||||    
T  15159 ataggaggaaaagtaggtctagc 15181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144 (Bit Score: 62; Significance: 1e-26; HSPs: 2)
Name: scaffold0144
Description:

Target: scaffold0144; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 252 - 517
Target Start/End: Original strand, 26551 - 26816
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  26551 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 26650  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||| | ||||||||| |    
T  26651 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcatttacagaggattcagc 26750  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  26751 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 26816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 42 - 157
Target Start/End: Original strand, 26338 - 26453
Alignment:
Q  42 ggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggag 141  Q
    ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | ||||||||| ||||    
T  26338 ggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggtataggag 26437  T
Q  142 gaaaagtaggtctagc 157  Q
    |||||||||| |||||    
T  26438 gaaaagtaggcctagc 26453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350 (Bit Score: 59; Significance: 9e-25; HSPs: 2)
Name: scaffold0350
Description:

Target: scaffold0350; HSP #1
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 252 - 434
Target Start/End: Original strand, 7588 - 7770
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  7588 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 7687  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 434  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||| ||||||    
T  7688 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctcttcgatgca 7770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 7368 - 7490
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  7368 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 7467  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  7468 atcggagggaaagtaggcctagc 7490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 51; Significance: 5e-20; HSPs: 3)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 35 - 157
Target Start/End: Original strand, 9195 - 9317
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9195 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9294  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  9295 atcggagggaaagtaggcctagc 9317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 35 - 157
Target Start/End: Complemental strand, 20142 - 20020
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  20142 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 20043  T
Q  135 atcggaggaaaagtaggtctagc 157  Q
    |||||||| |||||||| |||||    
T  20042 atcggagggaaagtaggcctagc 20020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 252 - 430
Target Start/End: Original strand, 9415 - 9593
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| || || |||||||    
T  9415 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcgacggtagcca 9514  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttga 430  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||||||    
T  9515 tggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctctttga 9593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 252 - 517
Target Start/End: Complemental strand, 7844 - 7579
Alignment:
Q  252 tactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 351  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
T  7844 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 7745  T
Q  352 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 451  Q
    | |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||| |||||| | |  || |||||| |    
T  7744 tagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgtagaagattcagc 7645  T
Q  452 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 517  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
T  7644 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 7579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 148
Target Start/End: Complemental strand, 8076 - 7963
Alignment:
Q  35 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 134  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  8076 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 7977  T
Q  135 atcggaggaaaagt 148  Q
    || |||||||||||    
T  7976 ataggaggaaaagt 7963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0496 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0496
Description:

Target: scaffold0496; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 327 - 367
Target Start/End: Original strand, 157 - 197
Alignment:
Q  327 gcattaataggggcaacagtagccatggattgaccggctcc 367  Q
    ||||| ||||| |||||||||||||| ||||||||||||||    
T  157 gcattgataggtgcaacagtagccattgattgaccggctcc 197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University