View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11051_low_6 (Length: 245)
Name: NF11051_low_6
Description: NF11051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11051_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 14213176 - 14213406
Alignment:
| Q |
1 |
taagagcaacaaaccaagtaatgatttggaattgaagcagtgaattcatcttcatcaagcattgctggaacttgaagcatttcttctgactttttaaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14213176 |
taagagcaacaaaccaagtaatgatttggaattgaagcagtgaattcatcttcatcaagcattgctggaacttgaagcatttcttctgactttttaaggt |
14213275 |
T |
 |
| Q |
101 |
taaaagatctttgttctggatgttgtgattgtattgcaatttcaatgttgtcaatgccataataaagattggataagactgattggtcagagaattcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14213276 |
taaaagatctttgttctggatgttgtgattgtattgcaatttcaatgttgtcaatgccataataaagattggataagactgattggtcagagaattcaaa |
14213375 |
T |
 |
| Q |
201 |
gaattcttggttttgagtccttaagtttgat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14213376 |
gaattcttggttttgagtccttaagtttgat |
14213406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University