View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11052_high_11 (Length: 343)
Name: NF11052_high_11
Description: NF11052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11052_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 9e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 61 - 302
Target Start/End: Complemental strand, 2841263 - 2841019
Alignment:
| Q |
61 |
ttttgttgaaatttgtggatttgacaaaccaccgtaatatgtgatacatgcacttgcactatatcatataactccagcacaatagccttcaatcaccaaa |
160 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||| ||||||||||||| | |
|
|
| T |
2841263 |
ttttgtttaaatttgtgtttttgacaaaccaccgtaatatgtgatacatgcactagcactatatcagataactccaacacaataaccttcaatcaccata |
2841164 |
T |
 |
| Q |
161 |
tgccacaggtttctaaattgcagggacacactctgtggtgactgttcgtagctccatta---gttgccgacatcaaaatacaacaatttcaacatgaaca |
257 |
Q |
| |
|
||| |||||||||| ||||||||| | ||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2841163 |
tgcaacaggtttctgaattgcaggtatacactctgtagtgactgttcgtagctccattaattgttaccgacatcaaaatacaacaatttcaacatgaaca |
2841064 |
T |
 |
| Q |
258 |
gaaaccatttgactcttgactgtatatcacacaatcacaaccaac |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2841063 |
gaaaccatttgactcttgactgtatatcacacagtcacaaccaac |
2841019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University