View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11052_high_22 (Length: 240)
Name: NF11052_high_22
Description: NF11052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11052_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 43651124 - 43650900
Alignment:
| Q |
1 |
ttgggacctaattgatagttgcataaagaactctgcctggaaacaaagaatcagtgtaatattgagaatttgatttatttttaatactaatgacgcagct |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43651124 |
ttgggtcctaattgatagttgcataaagaactctgcctggaaacaaagaatcagtgtaatattgagaatttgatttatttttaatactaatgatgcagct |
43651025 |
T |
|
| Q |
101 |
acatgttagttttaaggtgagggatttataaattttcggtcttctcttatgtcgtataccattggaaaaaaccttagtctaacataaagtaaagaccgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
43651024 |
gcatgttagttttaaggtgagggatttataaattttcggtcttctcttatgtcgtataccattggaaaaaatcttagtctaacataaagtaaagactgaa |
43650925 |
T |
|
| Q |
201 |
ctaaatttataaaaagtgacacttc |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43650924 |
ctaaatttataaaaagtgacacttc |
43650900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University