View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11052_low_17 (Length: 267)
Name: NF11052_low_17
Description: NF11052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11052_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 260
Target Start/End: Complemental strand, 32988157 - 32987913
Alignment:
| Q |
17 |
gctttcaccgttcacatcttccataaatatcaatcaataaatatatcaacctactagcatatcataacagtgagctaaccaaaagaagctaaagaatacg |
116 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32988157 |
gctttcaccgtttatatcttccataaatatcaatcaaaa----tatcaacctactagcatatcataacagtgagccaaccaaaagaagctaaagaatacg |
32988062 |
T |
 |
| Q |
117 |
aggtgtagt-----tttaaggttacaaatttgccatcatgctaactaagaaaacaatccacgtggtcaacaaatctatgtctttttatcgactttccaca |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32988061 |
aggtgtagtgtagttttaaggttacaaatttgccatcatgctaactaagaaaacaatccacatggtcaacaaatctatgtctttttatcgactttccaca |
32987962 |
T |
 |
| Q |
212 |
gcttcattctccactgcttatgaacgtgctgaagtatatgttcttctct |
260 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32987961 |
gcttcattctctactgcttatgaacgtgctgaagtatatgttcttctct |
32987913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University