View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11052_low_20 (Length: 250)
Name: NF11052_low_20
Description: NF11052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11052_low_20 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 43651377 - 43651142
Alignment:
| Q |
14 |
gaacattagttaataatgaacacatgcaaaattagcatttccacaaatgtgttactaatttttcttaagaaggaaatagtatacaccaaacacttgtttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43651377 |
gaacattagttaataatgaacacatgcaaaattagcatttccacaaatgtgttactaatttttcttaagaaggaaatagtatacaccaaacacttgtttt |
43651278 |
T |
|
| Q |
114 |
gattctatctaattacttgatacaattagaattttggacatgtgaacaatttgttggagtggtttgctctatcagtatcatatagggattacgttacgta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43651277 |
gattctatctaattacttgatacaattagaattttgaacatgtgaacaatttgttggagtgg-ttgctctatcagtatcatatagggattacgttatgta |
43651179 |
T |
|
| Q |
214 |
tcatgatctcaatgacattcattaatctacgatgtct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43651178 |
tcatgatctcaatgacattcattaatctacgatgtct |
43651142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University