View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11052_low_21 (Length: 249)
Name: NF11052_low_21
Description: NF11052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11052_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 35491338 - 35491427
Alignment:
| Q |
1 |
tagtgtgtactgatgcaatgcaatatattattggcaattatatgatgaagatttcactaattttttgttttccataagcttatagtaatg |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35491338 |
tagtgtgtactgatgcaatgcaatatattattggcaattatatgatgaagatttcactaattttttgttttccataagcttataataatg |
35491427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 35497570 - 35497652
Alignment:
| Q |
1 |
tagtgtgtactgatgcaatgcaatatattattggcaattatatgatgaagatttcactaattttttgttttccataagcttata |
84 |
Q |
| |
|
|||||| |||| |||| ||||||| || |||||||||||||||||||||||||| ||||||||||| |||| | || ||||||| |
|
|
| T |
35497570 |
tagtgtctactaatgccatgcaat-tactattggcaattatatgatgaagattttactaattttttatttttcctatgcttata |
35497652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University