View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11052_low_24 (Length: 234)
Name: NF11052_low_24
Description: NF11052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11052_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 39998814 - 39998988
Alignment:
| Q |
1 |
agggaagttgcttggttagttttgtttcttcattttctgattatgtgttgttgaatgatttatgtgaattaatttactttagcagcttagatcgtataaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39998814 |
agggaagttgcttggttagttttgtttcttcattttctgattatgcgttgttgaatgatttatgtgaattaatttactttagcagcttagatcgtataaa |
39998913 |
T |
 |
| Q |
101 |
aacggacgttgcaaagatgcatgaggatctgggttttcaataacatctatgaattagataaagagcaactagtca |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39998914 |
aacggacgttgcaaagatgcatgaggatctgggttttcaataacatctatgaattagataaagagcaactagtca |
39998988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 156
Target Start/End: Complemental strand, 40757341 - 40757292
Alignment:
| Q |
107 |
cgttgcaaagatgcatgaggatctgggttttcaataacatctatgaatta |
156 |
Q |
| |
|
|||||||||||||||||||||||| | ||| |||||| |||||||||||| |
|
|
| T |
40757341 |
cgttgcaaagatgcatgaggatctagatttccaataaaatctatgaatta |
40757292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 34010027 - 34010079
Alignment:
| Q |
104 |
ggacgttgcaaagatgcatgaggatctgggttttcaataacatctatgaatta |
156 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||| |||||| |||||||||||| |
|
|
| T |
34010027 |
ggacgttgcaaagatgcaagaggatctgagtttccaataaaatctatgaatta |
34010079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University