View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11052_low_24 (Length: 234)

Name: NF11052_low_24
Description: NF11052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11052_low_24
NF11052_low_24
[»] chr2 (2 HSPs)
chr2 (1-175)||(39998814-39998988)
chr2 (107-156)||(40757292-40757341)
[»] chr1 (1 HSPs)
chr1 (104-156)||(34010027-34010079)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 39998814 - 39998988
Alignment:
1 agggaagttgcttggttagttttgtttcttcattttctgattatgtgttgttgaatgatttatgtgaattaatttactttagcagcttagatcgtataaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39998814 agggaagttgcttggttagttttgtttcttcattttctgattatgcgttgttgaatgatttatgtgaattaatttactttagcagcttagatcgtataaa 39998913  T
101 aacggacgttgcaaagatgcatgaggatctgggttttcaataacatctatgaattagataaagagcaactagtca 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39998914 aacggacgttgcaaagatgcatgaggatctgggttttcaataacatctatgaattagataaagagcaactagtca 39998988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 156
Target Start/End: Complemental strand, 40757341 - 40757292
Alignment:
107 cgttgcaaagatgcatgaggatctgggttttcaataacatctatgaatta 156  Q
    |||||||||||||||||||||||| | ||| |||||| ||||||||||||    
40757341 cgttgcaaagatgcatgaggatctagatttccaataaaatctatgaatta 40757292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 34010027 - 34010079
Alignment:
104 ggacgttgcaaagatgcatgaggatctgggttttcaataacatctatgaatta 156  Q
    |||||||||||||||||| ||||||||| |||| |||||| ||||||||||||    
34010027 ggacgttgcaaagatgcaagaggatctgagtttccaataaaatctatgaatta 34010079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University