View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11052_low_25 (Length: 209)
Name: NF11052_low_25
Description: NF11052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11052_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 26492628 - 26492450
Alignment:
| Q |
17 |
agaatttgcatcaaattcagtgtaagtgtcaaacctaggggttctaattctatgatcctatgaataaactatagtaattattcactatacctaagaacgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26492628 |
agaatttgcatcaaattcagtgtaagtgtcaaacctaggggttctaattctatgatcctatgaataaactatagtaattattcactatacctaagaacgt |
26492529 |
T |
 |
| Q |
117 |
acgcaatattagttcattaattacttaatttgattaacaatttcaatcttttgggttcctacgatgatggctgcctatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26492528 |
acgcaatattagttcattaattacttaatttgattaacaatttcaatcttttgggttcctacgatgatggctgcctatg |
26492450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University