View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11053_high_1 (Length: 363)
Name: NF11053_high_1
Description: NF11053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11053_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 18 - 353
Target Start/End: Complemental strand, 42038485 - 42038150
Alignment:
| Q |
18 |
agtttgttcttcttcaggatcttggttgcttttgtgtctttttgggggttgggttatagtaagatggttaggttatgtttgacgcttgtttgacatgacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
42038485 |
agtttgttcttcttcaggatcttggttgcttttgtgtctttttgggggttgggttatagtaagatggtcaggttatgtttgacgcttgtttgacatggcg |
42038386 |
T |
 |
| Q |
118 |
cttgtatgacatgttgtctagcggactatttggaactctcacaatgatctaatctttgttgggatgatctatttatgttgagttcttgttggatagggca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038385 |
cttgtatgacatgttgtctagcggactatttggaactctcacaatgatctaatctttgttgggatgatctatttatgttgagttcttgttggatagggca |
42038286 |
T |
 |
| Q |
218 |
aagtttgatcgatagggcaaaattttgatggtggaagtgtttctcggtaaaatcttggcagtgcatacttcttctatgagtgggagacacatccagccat |
317 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42038285 |
aagtttgatcgatagggcaaaattttgatcgtggaagtgtttctcggtaaaatcttggcagtgcatacttcttctatgagtgggagacacatccagccgt |
42038186 |
T |
 |
| Q |
318 |
gagttggaaccgtagaatcttgtgtgagtgtctgtg |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038185 |
gagttggaaccgtagaatcttgtgtgagtgtctgtg |
42038150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University