View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11054_high_8 (Length: 372)
Name: NF11054_high_8
Description: NF11054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11054_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 8 - 357
Target Start/End: Original strand, 6820916 - 6821265
Alignment:
| Q |
8 |
tgagatgaaaaatacaattgatcttcttcagcaattgacagaaacttgcaccatccgaagagaggattcagccaaagttgttggtttgaaaatcaaagaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6820916 |
tgagatgaaaaatacaattgatcttcttcagcaattgacagaaacttgcaccatccgaagagaggattcagccaaagttgttggtttgaaaatcaaagaa |
6821015 |
T |
|
| Q |
108 |
caagatttggtcttgaatctgactgcaagcagtgataatgcttcgaaactttgcattgtggggatgaaaggtgtggggaagacaactctggcaaaggcag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6821016 |
caagatttggtcttgaatctgactgcaagcagtgataatgcttcgaaactttgcattgtggggatgaaaggtgtggggaagacagctctggcaaaggcag |
6821115 |
T |
|
| Q |
208 |
tttgttataacaaagttgttgtcaagcacttccctacccgagtctgggcaacagtaattgcaggagcaaccgcaaccatgaaagttctgctcatggaaaa |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6821116 |
tttgttataacaaagttgttgtcaagcacttcccaacccaagtctgggcaacagtaattgcaggagcaaccgcaaccatgaaagttctgctcatggaaaa |
6821215 |
T |
|
| Q |
308 |
caacgggactaaaaaccaaacattgaccatgaaacaggtacgtggtcatt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6821216 |
caacgggactaaaaaccaaacattgaccatgaaacaggtacgtggtcatt |
6821265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 155 - 275
Target Start/End: Original strand, 7333387 - 7333507
Alignment:
| Q |
155 |
actttgcattgtggggatgaaaggtgtggggaagacaactctggcaaaggcagtttgttataacaaagttgttgtcaagcacttccctacccgagtctgg |
254 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||| | | ||| ||||||||||| ||| |||||| |
|
|
| T |
7333387 |
actttccattgtggggatgaaaggtgtggggaagacaactctggcaaaggtagtttattacaacaaagatatagtcgagcacttccctgtccgtgtctgg |
7333486 |
T |
|
| Q |
255 |
gcaacagtaattgcaggagca |
275 |
Q |
| |
|
| ||||||| || ||||||| |
|
|
| T |
7333487 |
gtgacagtaactgaaggagca |
7333507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University