View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11055_high_18 (Length: 216)

Name: NF11055_high_18
Description: NF11055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11055_high_18
NF11055_high_18
[»] chr8 (2 HSPs)
chr8 (17-201)||(1159372-1159556)
chr8 (122-200)||(1166339-1166417)


Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 1159372 - 1159556
Alignment:
17 taacaagaaggagaagaggcttgcgatttcgactgcggtagcgagtgcggcggtggatacagttgtggtggaggaatttggagatgagtttgaggggaat 116  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
1159372 taacaagaaggagaagaggcttgcgatttccactgcggtagcgagtgcggcggtgaatacagttgtggtggaggaatttggagatgagtttgaggggaat 1159471  T
117 gcgaagacgaaggagtttattgcggcgatgaaaaggtggggattggatccgacggagaaagttacgttttttatgatggaggtga 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1159472 gcgaagacgaaggagtttattgcggcgatgaaaaggtggggattggatccgacggagaaagttacgttttttatgatggaggtga 1159556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 122 - 200
Target Start/End: Original strand, 1166339 - 1166417
Alignment:
122 gacgaaggagtttattgcggcgatgaaaaggtggggattggatccgacggagaaagttacgttttttatgatggaggtg 200  Q
    |||||||| ||||||  |||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||    
1166339 gacgaaggggtttatcacggcgatgaaaaggtggggattggatccgacgaagaaagtgatgttttttatgatggaggtg 1166417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University