View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11055_low_18 (Length: 216)
Name: NF11055_low_18
Description: NF11055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11055_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 1159372 - 1159556
Alignment:
| Q |
17 |
taacaagaaggagaagaggcttgcgatttcgactgcggtagcgagtgcggcggtggatacagttgtggtggaggaatttggagatgagtttgaggggaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1159372 |
taacaagaaggagaagaggcttgcgatttccactgcggtagcgagtgcggcggtgaatacagttgtggtggaggaatttggagatgagtttgaggggaat |
1159471 |
T |
 |
| Q |
117 |
gcgaagacgaaggagtttattgcggcgatgaaaaggtggggattggatccgacggagaaagttacgttttttatgatggaggtga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1159472 |
gcgaagacgaaggagtttattgcggcgatgaaaaggtggggattggatccgacggagaaagttacgttttttatgatggaggtga |
1159556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 122 - 200
Target Start/End: Original strand, 1166339 - 1166417
Alignment:
| Q |
122 |
gacgaaggagtttattgcggcgatgaaaaggtggggattggatccgacggagaaagttacgttttttatgatggaggtg |
200 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
1166339 |
gacgaaggggtttatcacggcgatgaaaaggtggggattggatccgacgaagaaagtgatgttttttatgatggaggtg |
1166417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University