View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11056_high_4 (Length: 259)

Name: NF11056_high_4
Description: NF11056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11056_high_4
NF11056_high_4
[»] chr7 (1 HSPs)
chr7 (76-195)||(43418822-43418941)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 76 - 195
Target Start/End: Complemental strand, 43418941 - 43418822
Alignment:
76 cgtactgggttggattggcgatcaatgagtgaaacagcattaacagagttagttgaatcgggttgaccccacctatctactaccttgggacctccttgta 175  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
43418941 cgtactgggttggattggcgatgaatgagtgaaacagcgttaacagacttagttgaatcgggttgaccccacctatctactaccttgggacctccttgta 43418842  T
176 tttcacgggattcgataact 195  Q
    ||||||||||||||||||||    
43418841 tttcacgggattcgataact 43418822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University