View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11056_high_6 (Length: 215)
Name: NF11056_high_6
Description: NF11056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11056_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 45175829 - 45175640
Alignment:
| Q |
17 |
aatattaatattgactttgtggtgagagatttgcgttcacaattggctgttattccaaccactaacgatcacgatcacgatcacgatcatcaacaatctc |
116 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45175829 |
aatattaatattgacttggtggtgagagatttgcgttcacagttggctgttattccaaccactaacgatctcgatcacgatcacgatcatcaacaatctc |
45175730 |
T |
 |
| Q |
117 |
tcttcaacttgaatcatatcaaagtccctaccaacaccgtcttctttccttcttctatggatccaaacaaaaaggtaatttcttctctct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45175729 |
tcttcaacttgaatcatatcaaagtccctaccaacaccgtcttctttccttcttcaatggatccaaacaaaaaggtaatttcttctctct |
45175640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University