View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11056_low_5 (Length: 259)
Name: NF11056_low_5
Description: NF11056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11056_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 76 - 195
Target Start/End: Complemental strand, 43418941 - 43418822
Alignment:
| Q |
76 |
cgtactgggttggattggcgatcaatgagtgaaacagcattaacagagttagttgaatcgggttgaccccacctatctactaccttgggacctccttgta |
175 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43418941 |
cgtactgggttggattggcgatgaatgagtgaaacagcgttaacagacttagttgaatcgggttgaccccacctatctactaccttgggacctccttgta |
43418842 |
T |
|
| Q |
176 |
tttcacgggattcgataact |
195 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43418841 |
tttcacgggattcgataact |
43418822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University