View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11057_high_6 (Length: 236)
Name: NF11057_high_6
Description: NF11057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11057_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 35309515 - 35309300
Alignment:
| Q |
12 |
gtgagatgaagctggatactattaacaaataagaaattacacatatt------aagtcggtacgagagaaattggattcaaattatttaagtaagatt-c |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||| | |
|
|
| T |
35309515 |
gtgaaatgaagctggatactattaacaaataagaaattacacatattcatattaagtcggtacgagtgaaattggattcgaattatttaagtaagatttc |
35309416 |
T |
 |
| Q |
105 |
aagttcaagtctcatgaatgaaaaatgtagttgaaatgaaggatttggaactgagacctactttagatgatcaatcaaaattctccgattacgattatat |
204 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35309415 |
aagttcaagtttcatgaatgaaaaacgtagttgaaatgaaggatttggaactgagacctattttagatgatcaatcaaaattctccgattatgattatat |
35309316 |
T |
 |
| Q |
205 |
tagagatacatgttag |
220 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
35309315 |
tagagatatatgttag |
35309300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University