View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11058_high_24 (Length: 233)
Name: NF11058_high_24
Description: NF11058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11058_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 24 - 213
Target Start/End: Complemental strand, 37573540 - 37573357
Alignment:
| Q |
24 |
aacaaaccattgtttactgctcactcactccctcgcacagctagctagctgtactgtacgtacgtgtgtacaatctctctctaatatctccttaccacgt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37573540 |
aacaaaccattgtttactgctcactcactccctcgcacagctagctagctgtactgtacgtacgtgtgtacaatctctctctaatctctccttaccacgt |
37573441 |
T |
 |
| Q |
124 |
gtctcttctgcaccgttatcatttcaaacaagatgaaataacttcataaagactcaatgccctaaccaattgtgtaatcaacttctaatt |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37573440 |
gtctctcctgcaccgttatcatttcaaacaagatcga------tcataaagactcaatgccctaaccaattgtgtaatcaacttctaatt |
37573357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University