View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11058_high_26 (Length: 231)

Name: NF11058_high_26
Description: NF11058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11058_high_26
NF11058_high_26
[»] chr7 (1 HSPs)
chr7 (18-123)||(33720985-33721089)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 123
Target Start/End: Complemental strand, 33721089 - 33720985
Alignment:
18 caattaaatggaaatcaaatggttacctacacttgcnnnnnnnngtgcttggaccttagacgagacaataccgatctcaaccagctagcttaatcaaagg 117  Q
    ||||||||||||||||||||||||||||||||||||        |||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
33721089 caattaaatggaaatcaaatggttacctacacttgcaaaaaaa-gtgcttggactttagacgagacaataccgatctcaaccagctagcttaatcaaagg 33720991  T
118 tctcaa 123  Q
    ||||||    
33720990 tctcaa 33720985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University