View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11058_high_27 (Length: 220)
Name: NF11058_high_27
Description: NF11058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11058_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 12 - 212
Target Start/End: Original strand, 31041320 - 31041523
Alignment:
| Q |
12 |
atgaataaaccatcgatttggtcttcgaactgtataaatataccaagtagcacctaaactatt---attaagaccataaaaatagtccttgagccaccat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
31041320 |
atgaataaaccatcgatttggtcttcgaactgtataaatataccaagtagcacctaaactattattattaagaccataaaaatagtccttgagcaaccat |
31041419 |
T |
 |
| Q |
109 |
tctctattgtttaagagaattgagggactaacttgatgcatttataatagtttatggactacttagcatgatttaatagttgaggagctgagagagggtg |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31041420 |
tccctattgtttaagagaattgagggactaacttgatgcatttataatagtttatggactacttagcatgatttaatagttgaggagctgagagagggtg |
31041519 |
T |
 |
| Q |
209 |
acga |
212 |
Q |
| |
|
|||| |
|
|
| T |
31041520 |
acga |
31041523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 173
Target Start/End: Original strand, 31768561 - 31768601
Alignment:
| Q |
133 |
ggactaacttgatgcatttataatagtttatggactactta |
173 |
Q |
| |
|
|||||||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
31768561 |
ggactaacttgatggatttatgatagtttaaggactactta |
31768601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University