View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11058_high_29 (Length: 213)
Name: NF11058_high_29
Description: NF11058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11058_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 30 - 197
Target Start/End: Complemental strand, 5116672 - 5116505
Alignment:
| Q |
30 |
ggagtatgtcgagttttgaacatgatgttggaagatcttgagaatccaccctcacctcgtttgttgaggcttttgatttcatgttattctcgcttatctc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5116672 |
ggagtatgtcgagttttgaacatgatgttggaagatcttgagaatccaccctcacctcgtttgttgaggcttttgatttcatgttattctcgtttatctc |
5116573 |
T |
 |
| Q |
130 |
aaaattacaggttggttgagaagttccatgatcttaagaatggttgaatatgcattttctcttgtttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5116572 |
aaaattacaggttggttgagaagttccatgatcttaagaatggttgaatatgccttttctcttgtttc |
5116505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University