View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11058_high_29 (Length: 213)

Name: NF11058_high_29
Description: NF11058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11058_high_29
NF11058_high_29
[»] chr3 (1 HSPs)
chr3 (30-197)||(5116505-5116672)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 30 - 197
Target Start/End: Complemental strand, 5116672 - 5116505
Alignment:
30 ggagtatgtcgagttttgaacatgatgttggaagatcttgagaatccaccctcacctcgtttgttgaggcttttgatttcatgttattctcgcttatctc 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
5116672 ggagtatgtcgagttttgaacatgatgttggaagatcttgagaatccaccctcacctcgtttgttgaggcttttgatttcatgttattctcgtttatctc 5116573  T
130 aaaattacaggttggttgagaagttccatgatcttaagaatggttgaatatgcattttctcttgtttc 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
5116572 aaaattacaggttggttgagaagttccatgatcttaagaatggttgaatatgccttttctcttgtttc 5116505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University